SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g39441

Feature Type:gene_model
Chromosome:Gm09
Start:44520921
stop:44524577
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g39441
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G45990AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 312 Blast hits to 312 proteins in 90 species: Archae - 0; Bacteria - 131; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). | chr2:18919402-18921043 FORWARD LENGTH=268 SoyBaseE_val: 4.00E-106ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010264GO-bp Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_C6TN79UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TN79_SOYBN SoyBaseE_val: 1.00E-131ISS
UniRef100_O82790UniRef Annotation by Michelle Graham. Most informative UniRef hit: AT2G45990 protein n=1 Tax=Arabidopsis thaliana RepID=O82790_ARATH SoyBaseE_val: 2.00E-103ISS

Expression Patterns of Glyma09g39441
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g39441 not represented in the dataset
Glyma09g39441 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g39441
ParalogEvidenceComments
Glyma18g46830 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g39441 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g258500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g39441
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g39441
>Glyma09g39441.1   sequence type=CDS   gene model=Glyma09g39441   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAAACGTTTTTACTTGTGAGATTGTTGCTTGAGAGCAGAACACCGTCCATCCGGAAGTCTTCGGTTGCAGAGGGGCTAACAGTTGAGGGTATATTGGAGAACTGGTCAAAGTTGAAGCCTATTATCATGGAAGAATGGGATGAGAAGAGGAATGATCTGATAGATCTTTTTGGAAAGGTCAGAGATGAATGGTTGGAGCAGGATTTTGCTACTTGGATTGGTGCAAACAGATTATATCCCGGTGTTTCTGATGCATTAAAATTTGCAAGCTCAAGAGTGTACATTGTAACCACAAAACAGTACCCAAACCCCTTGTTTCTCTTATTTCAAAGCCACTTTGCTGATGCTTTACTCCAAGAGCTTGCCGGAGTGGCTATACCACCTGAAAGAATATTTGGCCTTGGAACTGGTCCTAAGGTAGAAGTTCTGAAGCAGCTTCAAAAAAAGCCTGAGCACCAAGGACTGACACTACACTTTGTTGAAGATCGGCTAGCTACCTTAAAAAATGTCATCCAAGAACCTGAGTTAGACCAATGGAATTTGTATCTAGGTAATTGGGGTTACAACACCCGGAAAGAAAGAGAGGGTGCTGCAGCTATCCCCAGAATTCATGTTCTTGGGCTCTCCGACTTCAGCAAGAAGTTAAAATAG
Predicted protein sequences of Glyma09g39441
>Glyma09g39441.1   sequence type=predicted peptide   gene model=Glyma09g39441   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKTFLLVRLLLESRTPSIRKSSVAEGLTVEGILENWSKLKPIIMEEWDEKRNDLIDLFGKVRDEWLEQDFATWIGANRLYPGVSDALKFASSRVYIVTTKQYPNPLFLLFQSHFADALLQELAGVAIPPERIFGLGTGPKVEVLKQLQKKPEHQGLTLHFVEDRLATLKNVIQEPELDQWNLYLGNWGYNTRKEREGAAAIPRIHVLGLSDFSKKLK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo