Glyma09g38380 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g38380): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g38380): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g38380

Feature Type:	gene_model
Chromosome:	Gm09
Start:	43760071
stop:	43765526
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g38380

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G36170	AT	Annotation by Michelle Graham. TAIR10: high chlorophyll fluorescent 109 \| chr5:14236083-14237974 REVERSE LENGTH=456	SoyBase	E_val: 0	ISS
GO:0006364	GO-bp	Annotation by Michelle Graham. GO Biological Process: rRNA processing	SoyBase	N/A	ISS
GO:0006396	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA processing	SoyBase	N/A	ISS
GO:0006415	GO-bp	Annotation by Michelle Graham. GO Biological Process: translational termination	SoyBase	N/A	ISS
GO:0009657	GO-bp	Annotation by Michelle Graham. GO Biological Process: plastid organization	SoyBase	N/A	ISS
GO:0009902	GO-bp	Annotation by Michelle Graham. GO Biological Process: chloroplast relocation	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0010027	GO-bp	Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization	SoyBase	N/A	ISS
GO:0010207	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosystem II assembly	SoyBase	N/A	ISS
GO:0030154	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell differentiation	SoyBase	N/A	ISS
GO:0034660	GO-bp	Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process	SoyBase	N/A	ISS
GO:0035304	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation	SoyBase	N/A	ISS
GO:0042793	GO-bp	Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0003747	GO-mf	Annotation by Michelle Graham. GO Molecular Function: translation release factor activity	SoyBase	N/A	ISS
GO:0016149	GO-mf	Annotation by Michelle Graham. GO Molecular Function: translation release factor activity, codon specific	SoyBase	N/A	ISS
KOG2726	KOG	Mitochondrial polypeptide chain release factor	JGI		ISS
PTHR11075	Panther	PEPTIDE CHAIN RELEASE FACTOR	JGI		ISS
PTHR11075:SF38	Panther		JGI		ISS
PF00472	PFAM	RF-1 domain	JGI		ISS
PF03462	PFAM	PCRF domain	JGI		ISS
UniRef100_G7KSD8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Peptide chain release factor n=1 Tax=Medicago truncatula RepID=G7KSD8_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1L681	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1L681_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g38380

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g38380 not represented in the dataset	Glyma09g38380 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g38380 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g248300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g38380

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g38380

Limit To All Plant Sequences

>Glyma09g38380.1   sequence type=CDS   gene model=Glyma09g38380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGTTGTTTCGCAGCCTCTGTGCACAATTCTTACCCCCACGCGCAAACACTCACTTCTCATTCCACAACAAATCCCCAATCCTTCTAAACATTTTCCCTTCTTATCCTTTCGCGCCACCACTCTCTCCACTTCTTCGCGTTTTTCTCCTCCACCTCTTTTGTTCGCGACGCCGGAAAACCAATTGAGCATCGGGGAAGGAGAGAACACCGATGCAAGTGATTGGGCACTACAAGATTTTTATTCCCTGAGGAAGGATGTTGAAATTATGTCACAGCGTGTTGGAGAGATTAGAGAATCTTCTGGTCTACAGCTATTGGAGCAAGAACTTGGCAATTTGGAGGAGCAAGCAGCTGATAGCTCCTTTTGGGACAATCGGGGCAAAGCTCAAGAGACTCTCTCGACCTTGGCTGATGTCAAAGATAAGATAAAATTACTCAATGATTTCAAAACACAGGTTGAGGATGCAGAAACAATAGTTAGCTTGACTGAGGAAATGGACTCCATTGATAGAGGGCTTTTTGAGGAGGCTTCCAATCTTATTAAAGAACTGAATAAATCAATAGATCGATATGAGCTGACTCAACTTCTATCTGGTCCTTATGATAAAGAAGGTGCTGTTATCTCTATTACAGCAGGTGCTGGTGGTACTGATGCACAGGATTGGGCCGACATGCTTCTTAGGATGTACATGAGATGGGGTGAGAAACAGAAATACAAGACCAGAGTGGTTGAGAAATCCCCCGGAGAAGAAGCTGGAATTAAATCTGCTACCATTGAAGTTGAAGGTCGTTATGCATATGGATATTTGTCTGGGGAGAAAGGAACGCATCGCATTGTTCGTCAATCACCTTTTAATGCCAAAGGCCTTCGTCAGACAAGCTTTTCTGGTGTTGAGGTCATGCCTCTTCTTCCAGATGAATCTATGAATGTTGAAATTCCTGAGGAGGACCTGGAAATTAGTTTTTCAAGAGCAGGTGGAAAGGGAGGTCAGAATGTGAACAAGGTTGAAACTGCAGTTCGGATCACTCACATTCCAACTGGTGTCACTGTTCGCTGCACAGAGGAGAGATCCCAACTGGCAAATAAGATCAGAGCTTTAAGCCGTTTGAAAGCCAAGTTGTTGGTTATAGCTGAAGAGCAACGCGCATCAGAAATTAAGCAGATTCGGGGGGACGCAGTCAAGGCTGAATGGGGGCAACAAATACGGAACTATGTATTCCATCCGTACAAACTAGTAAAAGATGTAAGAACGGGGCATGAAACGACAGATATCACCTCTGTTATGGATGGCGAGTTGGATCCCTTCATCAAATCTTACCTCAAACACAAATACAATATGTCACTGTCTACAAGTGGGGTTAACTAA

Predicted protein sequences of Glyma09g38380

Limit To All Plant Sequences

>Glyma09g38380.1   sequence type=predicted peptide   gene model=Glyma09g38380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVVSQPLCTILTPTRKHSLLIPQQIPNPSKHFPFLSFRATTLSTSSRFSPPPLLFATPENQLSIGEGENTDASDWALQDFYSLRKDVEIMSQRVGEIRESSGLQLLEQELGNLEEQAADSSFWDNRGKAQETLSTLADVKDKIKLLNDFKTQVEDAETIVSLTEEMDSIDRGLFEEASNLIKELNKSIDRYELTQLLSGPYDKEGAVISITAGAGGTDAQDWADMLLRMYMRWGEKQKYKTRVVEKSPGEEAGIKSATIEVEGRYAYGYLSGEKGTHRIVRQSPFNAKGLRQTSFSGVEVMPLLPDESMNVEIPEEDLEISFSRAGGKGGQNVNKVETAVRITHIPTGVTVRCTEERSQLANKIRALSRLKAKLLVIAEEQRASEIKQIRGDAVKAEWGQQIRNYVFHPYKLVKDVRTGHETTDITSVMDGELDPFIKSYLKHKYNMSLSTSGVN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain