Report for Sequence Feature Glyma09g38050
Feature Type: gene_model
Chromosome: Gm09
Start: 43534923
stop: 43538649
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma09g38050
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G44730 AT
Annotation by Michelle Graham. TAIR10: Alcohol dehydrogenase transcription factor Myb/SANT-like family protein | chr2:18437447-18438565 REVERSE LENGTH=372
SoyBase E_val: 1.00E-71 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
KOG4282
KOG
Transcription factor GT-2 and related proteins, contains trihelix DNA-binding/SANT domain
JGI ISS
PF10545 PFAM
Alcohol dehydrogenase transcription factor Myb/SANT-like
JGI ISS
UniRef100_A2Q1W1 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: MADF; Homeodomain-like n=1 Tax=Medicago truncatula RepID=A2Q1W1_MEDTR
SoyBase E_val: 9.00E-93 ISS
UniRef100_I1L649 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L649_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma09g38050
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma09g38050
Paralog Evidence Comments
Glyma18g48343 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma09g38050 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.09g245300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma09g38050
Coding sequences of Glyma09g38050
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma09g38050.1 sequence type=CDS gene model=Glyma09g38050 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCCTCCCCTTCTTCCCCCACCGACTCCAACCCTCCCTCTGCCCTCCCCCTCCCTATCCCTCCCCCTCCCTCCACCTCCTCCCGCCGTCTCCCTCCTCCCTGCTGGACCCCCGAGGAAACCTCCGCCCTCATCGACGCCTACCGCGACAAATGGTACTCCCTCGGCCGCACCAACCTCAAGGCCACCCATTGGCAAGAGGTGGCCGACTCCGTCACGGCGCAGTGCCCCAACGCCTCCCCCACGGCCAAAACCCCCGTGCAGTGCCGCCACAAGATGGAGAAGCTCCGCAAACGGTACCGCACCGAAATCCAACGCCTCCGCAACCTCCCCCTTCCCCGCCTCAACAACGCCAGCACCAATTCCCCTTCCTCCTGGCTCCACTTCAAATCCATGGACTCCATGGAAAAAGGCCCCAACCACAAACCTCACGCCGACAACAACCTTAACATCAACAACAATTTCCACGATGACGACGTCGACGACGACGATCTGTACGAGGAATTCAAAAACGCCCCCGGATCCAACACCAGGAGCCTCAACAAGCTCTACAAGAACAACAACGGATTCAATTCGGCTGGTTCGGGCTCCGGATCCGGATTTCGGATCCGGATCCCGGCCGGCGTGCCACAACAACAACACCATACGGCGTCGTCAAATAAGATTTTTAACAGCCATCCTCCTCCCGGGATGGGGCCACGTGGCGGGGGCGTGAAGAGGGAGCGCGAGAGGGACGCGGTGGCGGAGATGGTGGGGGCTATTAAGGTCCTTCGCGACGGGTTCGTGAGGATGGAGCAGATGAAGATGGAGATGGCCAGGGAGATCGAGAGCATGCGGATGGAGATGGAGATGAAGCGCACCGAGATGATCCTGGACTCGCAGCAGAGGATTGTGGAGGCTTTTGCTAGGGCCGTTTCGCAGAAGAGGACCAAGGGCAAGTCCACGCCCTCGCCTTCATCGCAACCGTAG
Predicted protein sequences of Glyma09g38050
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma09g38050.1 sequence type=predicted peptide gene model=Glyma09g38050 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MASPSSPTDSNPPSALPLPIPPPPSTSSRRLPPPCWTPEETSALIDAYRDKWYSLGRTNLKATHWQEVADSVTAQCPNASPTAKTPVQCRHKMEKLRKRYRTEIQRLRNLPLPRLNNASTNSPSSWLHFKSMDSMEKGPNHKPHADNNLNINNNFHDDDVDDDDLYEEFKNAPGSNTRSLNKLYKNNNGFNSAGSGSGSGFRIRIPAGVPQQQHHTASSNKIFNSHPPPGMGPRGGGVKRERERDAVAEMVGAIKVLRDGFVRMEQMKMEMAREIESMRMEMEMKRTEMILDSQQRIVEAFARAVSQKRTKGKSTPSPSSQP*