Glyma09g37963 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g37963

Feature Type:	gene_model
Chromosome:	Gm09
Start:	43485068
stop:	43485658
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g37963

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
KOG3142	KOG	Prenylated rab acceptor 1	JGI		ISS
PF03208	PFAM	PRA1 family protein	JGI		ISS
UniRef100_E5GCA5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome p450 n=1 Tax=Cucumis melo subsp. melo RepID=E5GCA5_CUCME	SoyBase	E_val: 8.00E-09	ISS
UniRef100_UPI000233875B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233875B related cluster n=1 Tax=unknown RepID=UPI000233875B	SoyBase	E_val: 3.00E-140	ISS

Expression Patterns of Glyma09g37963

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g37963 not represented in the dataset	Glyma09g37963 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g37963

Paralog	Evidence	Comments
Glyma18g48420	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g37963 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g244400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g37963

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g37963

Limit To All Plant Sequences

>Glyma09g37963.1   sequence type=CDS   gene model=Glyma09g37963   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAATTATGGAACCACACAGAGAATACCCTCCTCCTCAACACCACCATCCACTGCAGACAATTATGAACCAGAACCAAAAGCACCCCAAGAAAAATTCTACAGTGATTTCAGAATCTACTGCCCCATTAACATTCCCTCCACATCAGAAGCTGCAGGAGTGCGCATCATGAGAAACATGTGCAATTTTGGGTTGTACTACACACTCTTTGTGTGGATCATACTCTTCATAACCCTCATCCCTCAGCGCAAGGTGTCATTGATTCTGTTTGTGACCATGACCTATGTGACAACCCTTTATATTTTACTCTTGAGGGTATTTCCAAACTCTGTTGTGCTTCACAGAATCATAGACAAAAGGGTTGTGTTGGCTTTGCTTGCAATTGCAACTGCGGTGCAGCTGATTTTGACTGAGGCAGGCATTCATCTTGCAGTGACTTTGGCTAGTAGTGTGCCTGTGCTTCTGGTTCATGCTGTTTTGTGGGCTAGCTATGATGCCTTTGAGGTTGAGGATGCTTCTGCAAAAGGAGAACTGGCTCCACTTGCAGGCCATAGTGAAAATGTTGATGACAATACTGATGCTGCTTAA

Predicted protein sequences of Glyma09g37963

Limit To All Plant Sequences

>Glyma09g37963.1   sequence type=predicted peptide   gene model=Glyma09g37963   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANYGTTQRIPSSSTPPSTADNYEPEPKAPQEKFYSDFRIYCPINIPSTSEAAGVRIMRNMCNFGLYYTLFVWIILFITLIPQRKVSLILFVTMTYVTTLYILLLRVFPNSVVLHRIIDKRVVLALLAIATAVQLILTEAGIHLAVTLASSVPVLLVHAVLWASYDAFEVEDASAKGELAPLAGHSENVDDNTDAA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain