Glyma09g37680 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g37680

Feature Type:	gene_model
Chromosome:	Gm09
Start:	43198403
stop:	43202099
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g37680

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G60390	AT	Annotation by Michelle Graham. TAIR10: homeobox-leucine zipper protein 3 \| chr3:22320788-22322370 REVERSE LENGTH=315	SoyBase	E_val: 1.00E-81	ISS
GO:0006351	GO-bp	Annotation by Michelle Graham. GO Biological Process: transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
KOG0483	KOG	Transcription factor HEX, contains HOX and HALZ domains	JGI		ISS
PTHR24326	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24326:SF218	Panther		JGI		ISS
PF00046	PFAM	Homeobox domain	JGI		ISS
PF02183	PFAM	Homeobox associated leucine zipper	JGI		ISS
PF04618	PFAM	HD-ZIP protein N terminus	JGI		ISS
UniRef100_I1L615	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L615_SOYBN	SoyBase	E_val: 3.00E-169	ISS
UniRef100_P46602	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Homeobox-leucine zipper protein HAT3 n=1 Tax=Arabidopsis thaliana RepID=HAT3_ARATH	SoyBase	E_val: 6.00E-79	ISS

Expression Patterns of Glyma09g37680

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g37680

Paralog	Evidence	Comments
Glyma18g48880	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g37680 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g241800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g37680

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g37680

Limit To All Plant Sequences

>Glyma09g37680.1   sequence type=CDS   gene model=Glyma09g37680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATACGAGGAATCGACGTCAATTCGGCGGCGGAGTGCGACGGCGTTTCCTCGCCGAACAGCGCTGTCTCGAGCGTGAGCGGCGGCGACGGCAAGCAGAGCGAGAGGGACGACGATAATAATGCTGCCGCCGTGGCCGGTGAGAGGACCTCGTGCTCGCGAGGGAGCGACGATGACGACGGTGGTGGCAGCGATGCCTCGAGGAAGAAGCTGAGGCTGACGAAAGAACAGTCCATGGTGTTGGAAGAAACGTTCAAGGAGCATAGCACGCTGAATCCGAAACGGAAGCAAGCGTTGGCAGAGGAGTTGAATCTGAAGCCCAGACAAGTAGAGGTGTGGTTTCAGAACAGAAGAGCAAGGACCAAGTTGAAGCAAACTGAAGTGGATTGTGAATACTTAAAGAGATGCTATGAGAATTTAACTGAAGAGAATAGAAGGTTGCACAAGGAGGTCCAAGAGCTTAGGGCATTGAAATTATCCCCACAAATGTACATGCATATGAACCCTCCCACCACTCTTACAATATGCCCTTCTTGTGAGCGTACTCACTCCTTTGCATCCTCCTCCACTGCCACCATCCACTCGGCGGTGGCGGCCACATCGAGCAATCGCAAACTGTTCGGCACAAACATCCGGCTGCCCGTGTCCTTCAACACTCGGCCATTTGAAGGCCCAATTCCTCGGCCATAA

Predicted protein sequences of Glyma09g37680

Limit To All Plant Sequences

>Glyma09g37680.1   sequence type=predicted peptide   gene model=Glyma09g37680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIRGIDVNSAAECDGVSSPNSAVSSVSGGDGKQSERDDDNNAAAVAGERTSCSRGSDDDDGGGSDASRKKLRLTKEQSMVLEETFKEHSTLNPKRKQALAEELNLKPRQVEVWFQNRRARTKLKQTEVDCEYLKRCYENLTEENRRLHKEVQELRALKLSPQMYMHMNPPTTLTICPSCERTHSFASSSTATIHSAVAATSSNRKLFGTNIRLPVSFNTRPFEGPIPRP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain