Glyma09g37540 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g37540

Feature Type:	gene_model
Chromosome:	Gm09
Start:	43078553
stop:	43080873
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g37540

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G54320	AT	Annotation by Michelle Graham. TAIR10: Integrase-type DNA-binding superfamily protein \| chr3:20114809-20118473 FORWARD LENGTH=430	SoyBase	E_val: 4.00E-92	ISS
GO:0006109	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0006110	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of glycolysis	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006629	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipid metabolic process	SoyBase	N/A	ISS
GO:0008610	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipid biosynthetic process	SoyBase	N/A	ISS
GO:0009744	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus	SoyBase	N/A	ISS
GO:0019432	GO-bp	Annotation by Michelle Graham. GO Biological Process: triglyceride biosynthetic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
PTHR11795	Panther	PROTEIN KINASE	JGI		ISS
PTHR11795:SF332	Panther		JGI		ISS
PF00847	PFAM	AP2 domain	JGI		ISS
UniRef100_G7KYV0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: AP2-like ethylene-responsive transcription factor n=1 Tax=Medicago truncatula RepID=G7KYV0_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI00023385E4	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI00023385E4 related cluster n=1 Tax=unknown RepID=UPI00023385E4	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g37540

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g37540

Paralog	Evidence	Comments
Glyma18g49101	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g37540 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g240400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g37540

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g37540

Limit To All Plant Sequences

>Glyma09g37540.2   sequence type=CDS   gene model=Glyma09g37540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAATGATGAAAGAGAATATTATTGAAGTGAGCCTTGGAAGGAGGCAAATGTCTATGACAGAAGGTGAGTTCCAAGGAACACGGAGCGTCAAGAGACGACGAAGAGAGGTTGCTGCAGCCGCAGGCAGTGGTGATGATAACCACCAACAGCAGTTACCACAACAAGAAGTTGGTGAAAATACTACAGTCAACACTACAAAGAGAAGCTCAAGATTTCGCGGTGTTAGCAGACATAGATGGACGGGTCGATATGAAGCTCACTTGTGGGACAAGCTTTCTTGGAACATAACACAAAAGAAGAAAGGGAAGCAAGTATACCTTGGGGCTTATGATGAAGAAGAATCTGCTGCCAGAGCATATGATTTAGCTGCACTTAAGTATTGGGGAACTTCAACTTTCACAAATTTTCCAATATCAGATTATGAGAAAGAGATACAAATAATGCAGACTATGACCAAAGAGGAGTATTTGGCCACTTTAAGGAGAAAGAGCAGTGGCTTTTCAAGAGGTGTATCAAAGTATAGGGGTGTTGCGAGGCACCACCACAATGGTAGATGGGAAGCAAGAATAGGAAGGGTTTTTGGAAACAAATATCTCTACCTTGGAACCTACAGCACCCAAGAGGAAGCTGCGCGTGCTTATGACATAGCAGCCATTGAGTACAGAGGAATTCATGCTGTAACAAACTTTGATTTGAGCACTTACATAAAATGGTTAAAGCCTTCAGGAGGAGGCACCCTAGAAGCAAATCTTGAATCACATGCAGCACTAGAGCATCAAAAGGTGGCATCCCCATCTAATTATGCTCTAACAGAAGAGTCTAAGTCTTTGGCCCTTCACAACAGTTTTTTCAGTCCATATTCTCTGGATTCCCCTGTAAAGCATGAAAGATTTGGAAACAAAACCTACCAATTCTCAAGCAATAAGTCATCTTCTCCCACTGCACTTGGTCTCCTTCTCCGCTCTTCGTTATTTAGGGAATTAGTTGAAAAGAATTCAAATGTTTCTGGAGAAGAAGATGATGGGGAAGCCACAAAGGATCAACAGACACAAATAGCTACTGATGATGATCTGGGTGGAATCTTCTTCGATAGCTTTAGTGATATTCCATTTGTGTGTGACCCCAATAGATACGACTTGGAATTGCAAGAAAGAGACCTGCACTCAATATTTTGA

Predicted protein sequences of Glyma09g37540

Limit To All Plant Sequences

>Glyma09g37540.2   sequence type=predicted peptide   gene model=Glyma09g37540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAMMKENIIEVSLGRRQMSMTEGEFQGTRSVKRRRREVAAAAGSGDDNHQQQLPQQEVGENTTVNTTKRSSRFRGVSRHRWTGRYEAHLWDKLSWNITQKKKGKQVYLGAYDEEESAARAYDLAALKYWGTSTFTNFPISDYEKEIQIMQTMTKEEYLATLRRKSSGFSRGVSKYRGVARHHHNGRWEARIGRVFGNKYLYLGTYSTQEEAARAYDIAAIEYRGIHAVTNFDLSTYIKWLKPSGGGTLEANLESHAALEHQKVASPSNYALTEESKSLALHNSFFSPYSLDSPVKHERFGNKTYQFSSNKSSSPTALGLLLRSSLFRELVEKNSNVSGEEDDGEATKDQQTQIATDDDLGGIFFDSFSDIPFVCDPNRYDLELQERDLHSIF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain