Glyma09g37340 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g37340

Feature Type:	gene_model
Chromosome:	Gm09
Start:	42909400
stop:	42911502
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g37340

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G28910	AT	Annotation by Michelle Graham. TAIR10: myb domain protein 30 \| chr3:10911443-10912856 FORWARD LENGTH=323	SoyBase	E_val: 9.00E-108	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0009626	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009739	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus	SoyBase	N/A	ISS
GO:0009751	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0042761	GO-bp	Annotation by Michelle Graham. GO Biological Process: very long-chain fatty acid biosynthetic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG0048	KOG	Transcription factor, Myb superfamily	JGI		ISS
PTHR10641	Panther	MYB-RELATED	JGI		ISS
PF00249	PFAM	Myb-like DNA-binding domain	JGI		ISS
UniRef100_E4W6I5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor MYB392 n=1 Tax=Glycine max RepID=E4W6I5_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_I1L5Y3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L5Y3_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g37340

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g37340

Paralog	Evidence	Comments
Glyma18g49360	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g37340 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g238800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g37340

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g37340

Limit To All Plant Sequences

>Glyma09g37340.1   sequence type=CDS   gene model=Glyma09g37340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGACCACCTTGTTGTGACAAAGAAGGGGTCAAGAAAGGGCCTTGGACTCCTGAAGAAGACATCATATTGGTGTCTTATATTCAGGAACATGGTCCTGGAAATTGGAGGGCAGTTCCTGCCAAAACAGGGTTGTCAAGATGCAGCAAGAGTTGCAGACTTAGATGGACGAATTACCTGAGGCCAGGAATCAAGCGTGGTAACTTCACAGAACAAGAGGAGAAGATGATAATCCATCTTCAAGATCTTTTAGGAAACAGATGGGCTGCAATAGCTTCATACCTTCCACAAAGAACAGACAATGACATAAAGAACTATTGGAATACCCATTTGAGAAAGAAGCTGAAGAAGATGCAAGCAGGCGGTGAAGGTGGTAGCTTTGGAGAAGGGTTTTCAGCCTCAAGGCAAATCCCTAGAGGCCAGTGGGAAAGAAGGCTCCAAACTGATATCCAAATGGCAAAGAGAGCCCTCAGTGAAGCTCTTTCACCAGAGAAAAAGCCATCTTGTTTATCTGCCTCAAACTCAAACCCTTCAGATAGTAGCAGCTCCTTCTCTTCCACAAAACCAACAACAACACAATCTGTGTGCTATGCATCAAGTGCTGACAACATAGCTAGAATGCTCAAGGGTTGGATGAAGAACCCACCAAAGTCCTCAAGAACCAACTCGTCTATGACTCAGAACTCATTCAACAACTTAGCAGGTGCTGATACTGCTTGTAGTAGTGGAGCAAAGGGACCACTAAGCAGTGCCGAATTGTCTGAGAATAATTTTGAATCCTTGTTTGATTTTGATCAGTCTTTGGAGTCTTCAAACTCTGATCAATTCTCTCAGTCCTTGTCTCCTGAGGCCACTGTTTTGCAAGATGAAAGCAAGCCTGATATTAATATTGCTGCAGAAATTATGCCCTTCTCTTTGCTTGAGAAATGGCTCCTTGATGAGGCAGGTTGCCAAGAGAAATTAGTTGGTTGTTGTGGTGATGCCAAGTTTTTCTAA

Predicted protein sequences of Glyma09g37340

Limit To All Plant Sequences

>Glyma09g37340.1   sequence type=predicted peptide   gene model=Glyma09g37340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRPPCCDKEGVKKGPWTPEEDIILVSYIQEHGPGNWRAVPAKTGLSRCSKSCRLRWTNYLRPGIKRGNFTEQEEKMIIHLQDLLGNRWAAIASYLPQRTDNDIKNYWNTHLRKKLKKMQAGGEGGSFGEGFSASRQIPRGQWERRLQTDIQMAKRALSEALSPEKKPSCLSASNSNPSDSSSSFSSTKPTTTQSVCYASSADNIARMLKGWMKNPPKSSRTNSSMTQNSFNNLAGADTACSSGAKGPLSSAELSENNFESLFDFDQSLESSNSDQFSQSLSPEATVLQDESKPDINIAAEIMPFSLLEKWLLDEAGCQEKLVGCCGDAKFF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain