SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g36185): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g36185): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g36185

Feature Type:gene_model
Chromosome:Gm09
Start:42012945
stop:42015619
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g36185
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G61415AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61450.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr1:22659661-22660420 FORWARD LENGTH=167 SoyBaseE_val: 1.00E-47ISS
UniRef100_O64775UniRef Annotation by Michelle Graham. Most informative UniRef hit: T1F9.6 n=1 Tax=Arabidopsis thaliana RepID=O64775_ARATH SoyBaseE_val: 8.00E-26ISS
UniRef100_UPI00023382EBUniRef Annotation by Michelle Graham. Best UniRef hit: UPI00023382EB related cluster n=1 Tax=unknown RepID=UPI00023382EB SoyBaseE_val: 2.00E-144ISS

Expression Patterns of Glyma09g36185
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g36185 not represented in the dataset
Glyma09g36185 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g36185 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g227800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g36185
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g36185
>Glyma09g36185.1   sequence type=CDS   gene model=Glyma09g36185   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGATTCAGGAGCGATTCTCGCTCACATTTCATCTCTGAAGGAAATGCTGGATCAGGTAAACGAAGAAATCGAGGCTAATATTCAGGTTACTCGAGAGATCGAATCCAGCATCGTCAAATGCGAGGAGATCGAGGCTGATTTGGCAACCAGGGAAGCCGAGTTGATCAGAACCAGTGCCATGTTGCAGTTCGACACCGTTGGATACGTCACCGTCGCTGCTGATTTCAGGGATTCAGTAAGTACCTTGGAGAAGGAGTTATGCTGTCTTAAAGTGAAGCGGGATGAGATCGTTAGTAAAGTAGATGAAAATCGGGAAAATTTCACAACGCTATGTCTAGAATTTCAGAGAGAAATTGACAAGAGAGAAGATTGTGAAGTGAGAGTCTTGTTGTCCGAGAAACATTCCCTTGAAAATGAAATTCAACTTTTGGATAAGAAAAATAATGTTTTGAAAAATTCAGTGTTGGCATTTGTGGAGGAGATTCTTGAAAATCTTCATAGTTCGAACTCAGCATTAGAAGTTCAGATACAGAGGAGGAACTGGGAGAATGAGAAATTGCTTAAGGATATCAATGATTTGAAGACTACACTACTTTCAGCAATTGGGACCAGCGATGATGTTCTATAA
Predicted protein sequences of Glyma09g36185
>Glyma09g36185.1   sequence type=predicted peptide   gene model=Glyma09g36185   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEDSGAILAHISSLKEMLDQVNEEIEANIQVTREIESSIVKCEEIEADLATREAELIRTSAMLQFDTVGYVTVAADFRDSVSTLEKELCCLKVKRDEIVSKVDENRENFTTLCLEFQREIDKREDCEVRVLLSEKHSLENEIQLLDKKNNVLKNSVLAFVEEILENLHSSNSALEVQIQRRNWENEKLLKDINDLKTTLLSAIGTSDDVL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo