SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g36160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g36160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g36160

Feature Type:gene_model
Chromosome:Gm09
Start:42001716
stop:42005398
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g36160
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G09680AT Annotation by Michelle Graham. TAIR10: reduced lateral root formation | chr5:2999362-3000185 REVERSE LENGTH=211 SoyBaseE_val: 9.00E-87ISS
GO:0010311GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root formation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
KOG0536 KOG Flavohemoprotein b5+b5R JGI ISS
PTHR19370Panther NADH-CYTOCHROME B5 REDUCTASE JGI ISS
PF00173PFAM Cytochrome b5-like Heme/Steroid binding domain JGI ISS
UniRef100_B9RVM7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Flavohemoprotein B5/b5r, putative n=1 Tax=Ricinus communis RepID=B9RVM7_RICCO SoyBaseE_val: 1.00E-90ISS
UniRef100_I1L5L6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L5L6_SOYBN SoyBaseE_val: 4.00E-159ISS

Expression Patterns of Glyma09g36160
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g36160 not represented in the dataset
Glyma09g36160 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g36160
ParalogEvidenceComments
Glyma12g01150 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g36160 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g227600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g36160
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g36160
>Glyma09g36160.1   sequence type=CDS   gene model=Glyma09g36160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACACTGATGATGATTTCACATTTTGTCAGGTCAGTGCACCTGTTGATCTTGAAACAAACAAGCTTGCTTCAGATATAGCTGATATTTCCATTGAAGAAGAATCTTCAAATGCAACTAATACTACTCAGGATAGTGCTTTACCCAATCAGAAGGAGGCTACTGTTGGTTCTTTGTCTTTCACTGTAACTAGCACAGCTTCTAGTCGGCCAAGTGAATCAACCACAAAATTAGTACCAGCTCAGGCTAACAACTCGTCTCTAAAGTCACCGGCACAGAAGAATTCCGTTAAGAAGCCAACGGTTCGGGCTAAAGTTCCTTTTGAGAAAGGCTATAGTCAAATGGACTGGCTCAAGCTCACCCAAACACATCCTGACCTTGCAGGTCTGAAAGGGCAGTCAAACAAGAGACTTATTTCTATGGATGAAGTTAGAAAACACCAGACCGAGGGCCAAATGTGGACTGTATTAAAAGGCCGTGTTTATAATATATCTCCATACATGAAGTTTCACCCTGGAGGTGTTAATATGTTGATGAAGGCAGTGGGAAAAGATTGCACATCTCTATTCAATAAATACCATGCTTGGGTTAATGCTGAATTCTTATTGGAAAAATGCTTTGTGGGTACCTTAGATGAAGGTCAGTGA
Predicted protein sequences of Glyma09g36160
>Glyma09g36160.1   sequence type=predicted peptide   gene model=Glyma09g36160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDTDDDFTFCQVSAPVDLETNKLASDIADISIEEESSNATNTTQDSALPNQKEATVGSLSFTVTSTASSRPSESTTKLVPAQANNSSLKSPAQKNSVKKPTVRAKVPFEKGYSQMDWLKLTQTHPDLAGLKGQSNKRLISMDEVRKHQTEGQMWTVLKGRVYNISPYMKFHPGGVNMLMKAVGKDCTSLFNKYHAWVNAEFLLEKCFVGTLDEGQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo