Glyma09g35860 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g35860

Feature Type:	gene_model
Chromosome:	Gm09
Start:	41742531
stop:	41744066
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g35860

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G47440	AT	Annotation by Michelle Graham. TAIR10: tonoplast intrinsic protein 5;1 \| chr3:17482054-17482987 FORWARD LENGTH=256	SoyBase	E_val: 2.00E-103	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0015840	GO-bp	Annotation by Michelle Graham. GO Biological Process: urea transport	SoyBase	N/A	ISS
GO:0048235	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen sperm cell differentiation	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0090406	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: pollen tube	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0015204	GO-mf	Annotation by Michelle Graham. GO Molecular Function: urea transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015250	GO-mf	Annotation by Michelle Graham. GO Molecular Function: water channel activity	SoyBase	N/A	ISS
KOG0223	KOG	Aquaporin (major intrinsic protein family)	JGI		ISS
PTHR19139	Panther	AQUAPORIN TRANSPORTER	JGI		ISS
PTHR19139:SF53	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00230	PFAM	Major intrinsic protein	JGI		ISS
UniRef100_B9R9T6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Tonoplast intrinsic protein, putative n=1 Tax=Ricinus communis RepID=B9R9T6_RICCO	SoyBase	E_val: 1.00E-126	ISS
UniRef100_UPI00023382E4	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI00023382E4 related cluster n=1 Tax=unknown RepID=UPI00023382E4	SoyBase	E_val: 4.00E-177	ISS

Expression Patterns of Glyma09g35860

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g35860

Paralog	Evidence	Comments
Glyma12g01490	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g35860 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g224700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g35860

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g35860

Limit To All Plant Sequences

>Glyma09g35860.1   sequence type=CDS   gene model=Glyma09g35860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCCATCTTCTGTCACTGTCACATCCCGTTTTCATGAATCCGTCACCCGCAATGCACTTCGCTCCTATCTCTCTGAGTTTATCTCCACTTTCTTCTATGTCTTTCTTGTCATTGGCGCTGGAATGTCCTCACGGAAGTTGATGCCTGATGCTTCACTGAACCCAACAAGTCTGGTTGTGGTTGGCATTGGAAGTGCATTTGCTTTGTCTTCTGTTCTGTACATCGCATGGGACATCTCCGGTGGACACGTCAATCCGGCTGTGACCTTTGCAATGGCAGTTGGAGGCCACATTAGTGTACCAACCGCTCTCTTTTACTGGGTTGCTCAACTCATAGCCTCTGTTATGGCTTGCCTTGTTTTAAGGGTCATTGTTGTTGGAATGCATGTTCCAACATACACCATTGCAGAAGAGATGACAGGGTTTGGAGCATCGGTGTTAGAGGGTACTCTGACATTTGTTTTGGTGTACACAGTGTATGCAGCCAGGGACCCTAGGCGTGGTCCAATGAGTTCCACTGGCATACTTGTAGTTGGCTTAATTGCTGGTGCAAGTGTCTTGGCCTCAGGTCCATTCTCTGGCGGCTCGATGAACCCTGCCTGTGCTTTTGGCTCGGCTGCCATTGCAGGCAGTTTCAGGAACCAAGCTGTGTATTGGGTTGGACCCTTGATTGGTGCTACCATTGCTGGCCTTCTTTATGACAATGTGTTGTTCCGTTCTCAACTCACAGATTCAATTCAAGGAATTGGGGTCTAA

Predicted protein sequences of Glyma09g35860

Limit To All Plant Sequences

>Glyma09g35860.1   sequence type=predicted peptide   gene model=Glyma09g35860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPSSVTVTSRFHESVTRNALRSYLSEFISTFFYVFLVIGAGMSSRKLMPDASLNPTSLVVVGIGSAFALSSVLYIAWDISGGHVNPAVTFAMAVGGHISVPTALFYWVAQLIASVMACLVLRVIVVGMHVPTYTIAEEMTGFGASVLEGTLTFVLVYTVYAARDPRRGPMSSTGILVVGLIAGASVLASGPFSGGSMNPACAFGSAAIAGSFRNQAVYWVGPLIGATIAGLLYDNVLFRSQLTDSIQGIGV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain