SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g35850): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g35850): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g35850

Feature Type:gene_model
Chromosome:Gm09
Start:41736010
stop:41741626
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G47450AT Annotation by Michelle Graham. TAIR10: P-loop containing nucleoside triphosphate hydrolases superfamily protein | chr3:17483195-17486249 REVERSE LENGTH=561 SoyBaseE_val: 0ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006399GO-bp Annotation by Michelle Graham. GO Biological Process: tRNA metabolic process SoyBaseN/AISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0006809GO-bp Annotation by Michelle Graham. GO Biological Process: nitric oxide biosynthetic process SoyBaseN/AISS
GO:0006897GO-bp Annotation by Michelle Graham. GO Biological Process: endocytosis SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010193GO-bp Annotation by Michelle Graham. GO Biological Process: response to ozone SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010322GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0051246GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein metabolic process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
KOG1249 KOG Predicted GTPases JGI ISS
PTHR11089Panther GTP-BINDING PROTEIN-RELATED JGI ISS
PTHR11089:SF36Panther JGI ISS
UniRef100_G7IGS4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nitric oxide synthase n=1 Tax=Medicago truncatula RepID=G7IGS4_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1L5I2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L5I2_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g35850 not represented in the dataset

Glyma09g35850 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma12g01500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g224600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g35850.1   sequence type=CDS   gene model=Glyma09g35850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGCTTAAAACCCTATCCACTTTCTTCTCACCTCTTTCTCTTCCCAACACCAAATTCCTCACCTCCAAGCCTTGCCTCATTCTCTTCGAATTCCCGCGCTCTCAGAAATCGCGCTTGCCCGTCGCCGATGCTGAAGGCACCGGCGCTGCCGCTCCTTCGCCCGGCGAGAAGTTCCTCGAACGCCAACAGTCCTTCGAAGATGCTAAGCTCATTCTCAAAGAGAACAACAAGAATAAGAAGAAAAAGAAGAAAGATAATGCTATAAAAGCTTCTAGAGCCGTCGCTTCTTGCTACGGCTGCGGCGCTCCGTTACACACTTCCGATGCCGATGCCCCTGGCTACGTCGATCCCGAAACCTATGAATTGAAGAAGAAACACCACCAGCTTCGAACCGTTCTGTGTAGGCGGTGCCGGCTTTTGTCTCATGGCAAGATGATAACTGCCGTTGGAGGACACGGTGGATACCCTGGCGGTAAATTATTCGTTTCTGCTGAAGAGCTTCGAGAAAAATTGTCTCACCTGCGTCACGAGAAAGCTCTAATTGTTAAATTGGTTGACATTGTTGACTTCAATGGCAGTTTTTTGTCTCGTGTGCGAGATCTTGCTGGTTCTAATCCAATAGTATTGGTGGTGACTAAGGTTGATCTCCTTCCAAGAGATACTGATCTTAACTGTGTTGGGGATTGGGTTGTAGAGGCTACTATGAGAAAGAAGCTAAATGTTCTCAGTGTCCATCTGACCAGTTCCAAATCATTGGTTGGAATAACTGGGGTGATATCAGAAATCCAGAAAGAGAAGAAGGGAAGAGATGTTTACATTCTGGGTTCAGCTAATGTTGGGAAATCTGCTTTCATCAATGCTTTACTAAAAACAATGGCTATAAATGATCCAGTGGCTGCATCTGCACAAAGATACAAACCAATACAATCTGCAGTTCCCGGAACTACCTTAGGGCCAATTCAAATTAATGCTTTCCTAGGAGGAGGGAAATTGTATGACACTCCTGGAGTTCATCTCTTCCATAGGCAAACTGCAGTTGTTCATTCTGAAGATCTACCCATCCTTGCTCCTCAAAGCCGACTGAGGGGCCTGGCTTTCCCAAGTTCTATAGTATCTTCAGACAATGTAGAGGAAGGAGCTTCCACTATAGTGAATGGCTTGAATGAATTTTCAATATTTTGGGGAGGTCTTGTTAGAATTGATGTCTTGAAGGTTCTCCCAGAAACTTGTTTGACATTTTATGGACCCAAGAGAATACCAATTCATATGGTACCCACTGAGCAAGCAGTTGAATTTTATCAGACAGAACTTGGATTTCTGCTGACCCCACCAAGTGGGGGAGAAAATGCTGAGAACTGGAAAGGACTTGAATCAGAACGTAAATTGCAAATAAAATTCGAAGTTGTGGACAGACCAGCTTGTGATATAGCTATATCAGGTCTAGGATGGTTTACTGTTGAGCCAGTTAGCAGGTCACACAAAATCTCGCAACCAAAACCTGTAGAGACTGCTGGGGAATTGATATTGGCTGTGCATGTCCCCAAGGCTGTTGAGATTTTTGTGAGGCCACCAATACCAGTAAGCAAGGCTGGAGCAGAGTGGTACCAGTATGTAGAATTAACAGAGAAACAAGAGGAAATGAGACCAAAATGGTACTTTTAA

>Glyma09g35850.1   sequence type=predicted peptide   gene model=Glyma09g35850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALKTLSTFFSPLSLPNTKFLTSKPCLILFEFPRSQKSRLPVADAEGTGAAAPSPGEKFLERQQSFEDAKLILKENNKNKKKKKKDNAIKASRAVASCYGCGAPLHTSDADAPGYVDPETYELKKKHHQLRTVLCRRCRLLSHGKMITAVGGHGGYPGGKLFVSAEELREKLSHLRHEKALIVKLVDIVDFNGSFLSRVRDLAGSNPIVLVVTKVDLLPRDTDLNCVGDWVVEATMRKKLNVLSVHLTSSKSLVGITGVISEIQKEKKGRDVYILGSANVGKSAFINALLKTMAINDPVAASAQRYKPIQSAVPGTTLGPIQINAFLGGGKLYDTPGVHLFHRQTAVVHSEDLPILAPQSRLRGLAFPSSIVSSDNVEEGASTIVNGLNEFSIFWGGLVRIDVLKVLPETCLTFYGPKRIPIHMVPTEQAVEFYQTELGFLLTPPSGGENAENWKGLESERKLQIKFEVVDRPACDIAISGLGWFTVEPVSRSHKISQPKPVETAGELILAVHVPKAVEIFVRPPIPVSKAGAEWYQYVELTEKQEEMRPKWYF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo