Glyma09g34170 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g34170

Feature Type:	gene_model
Chromosome:	Gm09
Start:	40606079
stop:	40615056
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g34170

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G35530	AT	Annotation by Michelle Graham. TAIR10: basic region/leucine zipper transcription factor 16 \| chr2:14923280-14926025 REVERSE LENGTH=409	SoyBase	E_val: 1.00E-164	ISS
GO:0006351	GO-bp	Annotation by Michelle Graham. GO Biological Process: transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006473	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein acetylation	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
GO:0046983	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity	SoyBase	N/A	ISS
KOG3584	KOG	cAMP response element binding protein and related transcription factors	JGI		ISS
PTHR22952	Panther	CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED	JGI		ISS
PTHR22952:SF36	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00170	PFAM	bZIP transcription factor	JGI		ISS
PF07777	PFAM	G-box binding protein MFMR	JGI		ISS
UniRef100_Q94KA7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: BZIP transcription factor 3 n=1 Tax=Phaseolus vulgaris RepID=Q94KA7_PHAVU	SoyBase	E_val: 0	ISS
UniRef100_UPI0001876ACA	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0001876ACA related cluster n=1 Tax=unknown RepID=UPI0001876ACA	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g34170

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g34170

Paralog	Evidence	Comments
Glyma01g01740	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g34170 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g208500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g34170

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g34170

Limit To All Plant Sequences

>Glyma09g34170.1   sequence type=CDS   gene model=Glyma09g34170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGCAGTGAGATGGATAAAACTACAAAAGAGAAGGAGTCAAAGACGCCGCCACCACCTACATCACAGGAGCAGTCTTCGACCACCGGCACTGGAACAATTAATCCTGAGTGGCCTGGCTTTCAGGCATATTCTCCTATACCTCCACATGGTTTCTTGGCATCAAGTCCCCAGGCTCACCCTTATATGTGGGGTGTCCAGCAATTTATGCCTCCCTATGGTACTCCACCACATCCCTATGTTGCAATGTATCCCCCTGGTGGCATTTATGCTCATCCATCCATGCCTCCGGGATCTTATCCTTTTAATCCTTTTGCCATGCCTTCTCCTAATGGCATTGCTGAGGCTTCAGGAAACACTCCTGGCAGCATGGAAGCTGATGGCAAGCCTTCTGAGGTGAAGGAAAAATTGCCAATCAAAAGATCAAAAGGAAGTTTGGGTAGTTTGAATATGATCACAGGGAAAAATAATGAACATGGTAAAACACTGGGGACATCTGCTAATGGAATTCATTCAAAGAGTGGTGAGAGTGCTAGTGAAGGTGAAGGTACCAGTGAAGGAAGTGATGCAAATTCTCAGAATGACTCTCAATTAAAATCAGGGGGCCGGCAGGATTCTTTTGAAGATGAACCCTCTCAAAATGGCAGTTCAGCATATACTCCTCAAAATGGGGGACTAAATATACCTCATACAGTGGTCAATCAAACCATGTCTATCATACCTATCTCTGCAGGTGGTGCTCCTGGAGCTGTTCCTGGTCCCACGACAAACTTAAATATAGGAATGGATTATTGGGGTACACCAGGTTCATCCAACATTCCTGGACTTGGCAGAAAGGTTCCATCTACTGCAGTTGCTGGAGGGATGGTTACTGTTGGATCACGGGATAGTGCTCAGTCACAACTCTGGCTACAGGATGAAAGAGAGCTTAAAAGGCAAAGGCGGAAGCAGTCTAACAGGGAATCTGCTCGCAGGTCCAGGTTGCGCAAGCAGGCCGAGTGTGATGAGTTAGCTCAGCGTGCTGAGGCTTTGAAGGAAGAAAATGCTTCTCTCCGGTCAGAAGTAAATCGAATCAGGAGTGATTATGAGCAGCTACTCTCCGAGAATGCAGCTCTCAAGGAGAGACTTGGGGAACTACCTCCGAATGATGATCATCATCATAGGTCTGGCAGGAATGATCAGCATGTGGGTAATGACACTCAACAGAGTGGGCAGACAGAGGCCGTGCAGGGTGGTCATTAG

Predicted protein sequences of Glyma09g34170

Limit To All Plant Sequences

>Glyma09g34170.1   sequence type=predicted peptide   gene model=Glyma09g34170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGSSEMDKTTKEKESKTPPPPTSQEQSSTTGTGTINPEWPGFQAYSPIPPHGFLASSPQAHPYMWGVQQFMPPYGTPPHPYVAMYPPGGIYAHPSMPPGSYPFNPFAMPSPNGIAEASGNTPGSMEADGKPSEVKEKLPIKRSKGSLGSLNMITGKNNEHGKTLGTSANGIHSKSGESASEGEGTSEGSDANSQNDSQLKSGGRQDSFEDEPSQNGSSAYTPQNGGLNIPHTVVNQTMSIIPISAGGAPGAVPGPTTNLNIGMDYWGTPGSSNIPGLGRKVPSTAVAGGMVTVGSRDSAQSQLWLQDERELKRQRRKQSNRESARRSRLRKQAECDELAQRAEALKEENASLRSEVNRIRSDYEQLLSENAALKERLGELPPNDDHHHRSGRNDQHVGNDTQQSGQTEAVQGGH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain