SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g34000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g34000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g34000

Feature Type:gene_model
Chromosome:Gm09
Start:40441282
stop:40447382
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G32230AT Annotation by Michelle Graham. TAIR10: WWE protein-protein interaction domain protein family | chr1:11613427-11615894 FORWARD LENGTH=589 SoyBaseE_val: 2.00E-139ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0000303GO-bp Annotation by Michelle Graham. GO Biological Process: response to superoxide SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006809GO-bp Annotation by Michelle Graham. GO Biological Process: nitric oxide biosynthetic process SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0008219GO-bp Annotation by Michelle Graham. GO Biological Process: cell death SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009743GO-bp Annotation by Michelle Graham. GO Biological Process: response to carbohydrate stimulus SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0009816GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010102GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root morphogenesis SoyBaseN/AISS
GO:0010193GO-bp Annotation by Michelle Graham. GO Biological Process: response to ozone SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0012501GO-bp Annotation by Michelle Graham. GO Biological Process: programmed cell death SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:2000377GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of reactive oxygen species metabolic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003950GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD+ ADP-ribosyltransferase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR14453Panther PARP/ZINC FINGER CCCH TYPE DOMAIN CONTAINING PROTEIN JGI ISS
PTHR14453:SF5Panther SUBFAMILY NOT NAMED JGI ISS
PF12174PFAM RST domain of plant C-terminal JGI ISS
UniRef100_A2Q3R6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Poly(ADP-ribose) polymerase, catalytic region n=1 Tax=Medicago truncatula RepID=A2Q3R6_MEDTR SoyBaseE_val: 2.00E-172ISS
UniRef100_I1J4R8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J4R8_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g34000 not represented in the dataset

Glyma09g34000 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g01900 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g207200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g34000.4   sequence type=CDS   gene model=Glyma09g34000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGCAAAAATCGCAAAGGCATTGGATAGGGTTGCACTCAATCTGAAGCGCAAGCGAGCGACCCGATATGCTGCACATTTAAGTGGAGCTTCACAACCAATGTTAGGGCATTGGTCATCTTTTACGTCACCAACAAGCAGGGCTGTCAAACGCATGAGATTGGGTGGATATAGAAACAGGCTGACAAATGCTGGTCCTCATATTGGACGGTCCTTAGCTAGGCGTTTTTTGAATTATAAAAAGAGTGGGAGACTGGAGCGTTTGATGTTCTATGAGAATGGGTCATGGTTGGACTTTCCAAAGGATGTTGTTGATTTGGTTAAGAAGGATCTTGAAATCAAGCGGGCAGCTGTGGAGATAGAGTCACATGGGTATCATCTTTTGTTTGATTTTTTACGTCTGCATAAGATGGACCTTAAAACTGGCTTGCAACAACCTATAGCTTTGATTGATGAGGCAGGGTGCTGTTTTTTCCCTGAAATCTATGCTGCTTCTGATGAAGAACCTTATAATTTGAGCAAACAGGAAGGTGGAAAAAGTCCAGACTCATATGCATCTAATGAAATAAAATTACATTTAGAAGTTGAAATAAATGGAGTGGATCAATCCAGGTTGAGTGAGTGTAGTGGGGAGTCCAATGCTCTAGTTAAGGGTATTCAAATTGATACTAAAGAAAACTGCTGTCAATATGATGTAGAAGTTGAAGATAGCATTAACAAAAAGGACTGTGGAAATGTTGGTGAAGACATTCAGCAACATCAAGACATAGGTTTAGATGCTTATACTGAATCAGTATATGGAAAATTGGATCTGAATTCTGTACAAAAGATGTTTCTTAAGGGAATGTGTAGTTTTGGCAGTACTGATTCTGACATAGTTGAGATTTACCACTGCTCAGGTGCGTCAATGCAAGCACGATGGGAGCTGTTCCAGAAGCAAGCTGAAATTACCAAAAAAAATCATGGGGAAGCTAACATTCGGTATGCTTGGCTTGCTTCCTCTAAAGGAGAACTATCTACAATGATGAACTATGGACTTAGTCATTATGGACTATCTGGATCAAAGTGCACATATGGCATTGGTGTTCATCTTGCTGCTGTTACTTGCCCTGATGCCAGTGTGCGTTATTGTGATGTTGACGAAAATGGGGTTCGACACTTGGCCCTTTGTCGTGTAATAATGGGGAACATGGAGATTCTTCGGCCTGGCACTGATCAGTTTCATCCCAGTAGTTGTGAATATGATAATGGGGTGGATGCCATTGAATGTCCACAATACTATGTGGTGTGGAATATGAACATGAACACCCACATCTATCCGGAATTCGTTGTTAGCTTTAAAGTCTCGTCTGACGCTGAAGGTCATTTTTGTGGAAGTGAGGGTAAGAATGTTTCTGGGGTTAATACAGCCTGTGACGGTCCTCATGGCTTGTTAAATTCAGAATCTTCTACTGTAGATAATGGAAAAGCTCCTAGTATGGTTTCTAGCACCCCAAAAGTTCCAAAATCCCCTTGGATGCCTTTTCCTGTGCTTCTTGATGCTATCAGAGATCAGGTTCCTCCCACGGGTATGGATGTAATCAAAACATATTATGAACAATTCAGGTCTAAGCATATATCCCGGGATGATTTTGTGAAGATGCTGAGGTTAATAGTTGGAGATGGTCTGTTGAGAACTACAATAACAAATCTTCAGTATAAGATACCTTCCGGTGGTGAATTGAAAGACTCAATCAAGAAAGAAGACTGA

>Glyma09g34000.4   sequence type=predicted peptide   gene model=Glyma09g34000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEAKIAKALDRVALNLKRKRATRYAAHLSGASQPMLGHWSSFTSPTSRAVKRMRLGGYRNRLTNAGPHIGRSLARRFLNYKKSGRLERLMFYENGSWLDFPKDVVDLVKKDLEIKRAAVEIESHGYHLLFDFLRLHKMDLKTGLQQPIALIDEAGCCFFPEIYAASDEEPYNLSKQEGGKSPDSYASNEIKLHLEVEINGVDQSRLSECSGESNALVKGIQIDTKENCCQYDVEVEDSINKKDCGNVGEDIQQHQDIGLDAYTESVYGKLDLNSVQKMFLKGMCSFGSTDSDIVEIYHCSGASMQARWELFQKQAEITKKNHGEANIRYAWLASSKGELSTMMNYGLSHYGLSGSKCTYGIGVHLAAVTCPDASVRYCDVDENGVRHLALCRVIMGNMEILRPGTDQFHPSSCEYDNGVDAIECPQYYVVWNMNMNTHIYPEFVVSFKVSSDAEGHFCGSEGKNVSGVNTACDGPHGLLNSESSTVDNGKAPSMVSSTPKVPKSPWMPFPVLLDAIRDQVPPTGMDVIKTYYEQFRSKHISRDDFVKMLRLIVGDGLLRTTITNLQYKIPSGGELKDSIKKED*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo