SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g33780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g33780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g33780

Feature Type:gene_model
Chromosome:Gm09
Start:40275712
stop:40278444
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G46700AT Annotation by Michelle Graham. TAIR10: Tetraspanin family protein | chr5:18951035-18952439 FORWARD LENGTH=269 SoyBaseE_val: 3.00E-135ISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0007568GO-bp Annotation by Michelle Graham. GO Biological Process: aging SoyBaseN/AISS
GO:0008361GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell size SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0009956GO-bp Annotation by Michelle Graham. GO Biological Process: radial pattern formation SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010015GO-bp Annotation by Michelle Graham. GO Biological Process: root morphogenesis SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010305GO-bp Annotation by Michelle Graham. GO Biological Process: leaf vascular tissue pattern formation SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0040007GO-bp Annotation by Michelle Graham. GO Biological Process: growth SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG3882 KOG Tetraspanin family integral membrane protein JGI ISS
PTHR19282Panther TETRASPANIN JGI ISS
PTHR19282:SF137Panther JGI ISS
PF00335PFAM Tetraspanin family JGI ISS
UniRef100_Q5UCF4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Senescence-associated protein DH n=1 Tax=Zea mays RepID=Q5UCF4_MAIZE SoyBaseE_val: 3.00E-87ISS
UniRef100_UPI0001D62D6BUniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001D62D6B related cluster n=1 Tax=unknown RepID=UPI0001D62D6B SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g33780 not represented in the dataset

Glyma09g33780 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g205400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g33780.1   sequence type=CDS   gene model=Glyma09g33780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAATGAGCAACAATGTGATCGGATGCATAAACTTCGTGGCGGTGATCCTCTCAATCCCAATCATCGGCGCCGGAATCTGGCTTTTAAACGGGGAAGCCGATTCCTGCGTCCAGTTCCTGCAATGGCCCGTCATCATCCTCGGAGTCCTCATCCTCGTCGTGGCCCTCGCAGGTTTCATCGGAGCCTTCTTCAGAGTCTCGTGGCTCCTCATCGTCTACCTCGTTGCCATGCTCGTCCTCGTCATACTCTTAGTGTCTTTGGTCGCTTTTGTTTACATGGTTACTCTTCGGGGACACGGCAACATTGAGCCCAACCGCGCTTACTTGGAGTACCGCATGGATGACTTTTCTGGCTACCTTCGTCGTAGGGTTAGAAGCTCGTTCAAGTGGGACCGCATCAGAAGCTGTCTTAGCCAAACCAACATGTGTGCTGAGCTTAACCAGGGTTATCGAATGGCTCAGGACTTCTTCAACGCGCGTCTAACGCCCATGCAGTCAGGGTGCTGCAAGCCACCAACGCAATGTGCGTACACGTTTGTGAATCCAACCTATTGGATTAGTCCCATCAACACAGCAGCGGATATGGATTGCCTGCAATGGAGCAACGACCAAACACAACTTTGCTACAACTGTGACTCGTGCAAGGCAGGTTTATTGGCAAATCTTAGGAAGGAGTGGAGAAGGGCCAATGTGATATTAATCATCACAGTCATTGTTTTAATAATTGTGTATTTGGTAGGGTGTTGTGCCTTTAGGAATGCCAAAACGGAGGACCTCTTCCGCAAATACAAACAAGGCTACACTTGA

>Glyma09g33780.1   sequence type=predicted peptide   gene model=Glyma09g33780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAMSNNVIGCINFVAVILSIPIIGAGIWLLNGEADSCVQFLQWPVIILGVLILVVALAGFIGAFFRVSWLLIVYLVAMLVLVILLVSLVAFVYMVTLRGHGNIEPNRAYLEYRMDDFSGYLRRRVRSSFKWDRIRSCLSQTNMCAELNQGYRMAQDFFNARLTPMQSGCCKPPTQCAYTFVNPTYWISPINTAADMDCLQWSNDQTQLCYNCDSCKAGLLANLRKEWRRANVILIITVIVLIIVYLVGCCAFRNAKTEDLFRKYKQGYT*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo