SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g30560): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g30560): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g30560

Feature Type:gene_model
Chromosome:Gm09
Start:37369689
stop:37372673
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G18270AT Annotation by Michelle Graham. TAIR10: ketose-bisphosphate aldolase class-II family protein | chr1:6283634-6293772 REVERSE LENGTH=1373 SoyBaseE_val: 5.00E-163ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006573GO-bp Annotation by Michelle Graham. GO Biological Process: valine metabolic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004332GO-mf Annotation by Michelle Graham. GO Molecular Function: fructose-bisphosphate aldolase activity SoyBaseN/AISS
GO:0004616GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphogluconate dehydrogenase (decarboxylating) activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0008442GO-mf Annotation by Michelle Graham. GO Molecular Function: 3-hydroxyisobutyrate dehydrogenase activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0016832GO-mf Annotation by Michelle Graham. GO Molecular Function: aldehyde-lyase activity SoyBaseN/AISS
GO:0050662GO-mf Annotation by Michelle Graham. GO Molecular Function: coenzyme binding SoyBaseN/AISS
PTHR22981Panther 3-HYDROXYISOBUTYRATE DEHYDROGENASE-RELATED JGI ISS
PTHR22981:SF30Panther PUTATIVE UNCHARACTERIZED PROTEIN JGI ISS
PF01116PFAM Fructose-bisphosphate aldolase class-II JGI ISS
PF07005PFAM Protein of unknown function, DUF1537 JGI ISS
UniRef100_G7KQ77UniRef Annotation by Michelle Graham. Most informative UniRef hit: D-tagatose-1,6-bisphosphate aldolase subunit gatY n=1 Tax=Medicago truncatula RepID=G7KQ77_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1KJ61UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KJ61_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g30560 not represented in the dataset

Glyma09g30560 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g11615 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g30560.1   sequence type=CDS   gene model=Glyma09g30560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCCAGTGCATTGATAAAAGAGATTTGCAGAAATCTGGACGCTGCAGCAAAATCAGTTGACAACATTGACTATACCGTAGTTTTGAGGGGAGATTCAACTTTACGTGGCCATTTTGATGAAGCAGATGTTGTTTCAGTATTGGGTGATATGGATGCATGGATAATTTGCCCCTTTTTCCTTCAAGGAGGCTTGTTCCTGCCGGGGACACTGAGTTTGCCAAAGATGCTTCCTTTGGCTACAAATCTTCAAACCTTGGGAGAGGAGAAAACAAATGGCCGAATACTTGGAAGTAGGGTTGCATCGATTTCTATCCAACTTTTGAGGAAAGGTGGTCCAGACGCAGTTTGTCGGCATCTATGCAGTTTGCAGAAGGGGTCAATATGCATAGTTAATGCAGCTAGTGAAAGAGACATGACTGCAGGATTGATGGGAAAACGTTTCTTGTGTCGCACTGCTGCTAGTTTTGTTTCTACACTTATGGGAATCATCTCTAAGCCTCCAATATTGCCAAATGATATAGGAATAGATAGAGAAAGGAATGGTGGTTTGATAGTTGTGGGATCCTATATTCCGAAAACAACAAAGCAGGTTGAAGAGCTCAAATTACAGTGTGGTCAGTTCTTAAAAAGCACTGAGGGGATCAACATTCCAAATTTCTTTACAACATTTTCCATTGTTGATTCTCTCACGGAGAGAATGATAAAGAAAGTATCAGCTGAAAAACTTGCAATGAGTCCTATTGAGGAGAGGGAGGAGGAAATCAGTAGAACAGCTGAATTAGCAGATGTATATCTTAAAGCTCATAAAGACACTCTAATAATGACCAGCCGAAATCTCATAACTGGAAGAACTGCCACTGAGAGTTTGGACATTAAGTTTAAAGTGGGCTCTGCTTTGGTGGAAATAGTGAAAAGAATAACTACAAAACCTCGCTATGTAATTGCAAAGTACATTTTCTGGGGTGGTATTACATCTTCAGACCTTGCTACAAAAGCCCTTGGTGCAAGATATGCGAAGATAGTTGGACAAGCACTTGCTGGTATTCCCTTGTGGCAATTAGGCCCTGAAAGTAGACATCCTGGAGTTCCTTACATTGTCTTCCCTGGTAATGTTGGTAACAGCACAGCATTTGCAGAAGTTGTAAAGTCCTGGACTAGTCCAATCAGACTTACATCAACAAAAGAAATTATCAACAATGCAGAAAAGGGTGGATATGCTGTTGGAGCATTTAATGTCTATAATTTGGAAGGAGTTGAGGCTGTTGTTTCAGCTGCAGAAGAAAGTCCTGCTATATTACAGGTCAGGAAC

>Glyma09g30560.1   sequence type=predicted peptide   gene model=Glyma09g30560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ASALIKEICRNLDAAAKSVDNIDYTVVLRGDSTLRGHFDEADVVSVLGDMDAWIICPFFLQGGLFLPGTLSLPKMLPLATNLQTLGEEKTNGRILGSRVASISIQLLRKGGPDAVCRHLCSLQKGSICIVNAASERDMTAGLMGKRFLCRTAASFVSTLMGIISKPPILPNDIGIDRERNGGLIVVGSYIPKTTKQVEELKLQCGQFLKSTEGINIPNFFTTFSIVDSLTERMIKKVSAEKLAMSPIEEREEEISRTAELADVYLKAHKDTLIMTSRNLITGRTATESLDIKFKVGSALVEIVKRITTKPRYVIAKYIFWGGITSSDLATKALGARYAKIVGQALAGIPLWQLGPESRHPGVPYIVFPGNVGNSTAFAEVVKSWTSPIRLTSTKEIINNAEKGGYAVGAFNVYNLEGVEAVVSAAEESPAILQVRN







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo