Glyma09g30534 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g30534): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g30534): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g30534

Feature Type:	gene_model
Chromosome:	Gm09
Start:	37354998
stop:	37357054
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g30534

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G17940	AT	Annotation by Michelle Graham. TAIR10: Galactose mutarotase-like superfamily protein \| chr3:6143707-6145244 REVERSE LENGTH=341	SoyBase	E_val: 5.00E-109	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0006012	GO-bp	Annotation by Michelle Graham. GO Biological Process: galactose metabolic process	SoyBase	N/A	ISS
GO:0019318	GO-bp	Annotation by Michelle Graham. GO Biological Process: hexose metabolic process	SoyBase	N/A	ISS
GO:0042732	GO-bp	Annotation by Michelle Graham. GO Biological Process: D-xylose metabolic process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004034	GO-mf	Annotation by Michelle Graham. GO Molecular Function: aldose 1-epimerase activity	SoyBase	N/A	ISS
GO:0016853	GO-mf	Annotation by Michelle Graham. GO Molecular Function: isomerase activity	SoyBase	N/A	ISS
GO:0030246	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate binding	SoyBase	N/A	ISS
PTHR10091	Panther	ALDOSE-1-EPIMERASE	JGI		ISS
PF01263	PFAM	Aldose 1-epimerase	JGI		ISS
UniRef100_B9SWV6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Aldose-1-epimerase, putative n=1 Tax=Ricinus communis RepID=B9SWV6_RICCO	SoyBase	E_val: 1.00E-115	ISS
UniRef100_UPI0002338D04	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002338D04 related cluster n=1 Tax=unknown RepID=UPI0002338D04	SoyBase	E_val: 4.00E-144	ISS

Expression Patterns of Glyma09g30534

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g30534 not represented in the dataset	Glyma09g30534 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g30534 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma09g30534

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g30534

Limit To All Plant Sequences

>Glyma09g30534.1   sequence type=CDS   gene model=Glyma09g30534   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATTTTGTTTGCTGTTTTCCTGATCCACTGTCCCCTCTCCAAATTTCAGGTGGAAATGTTGGGTTTGATAAGAAGGTATGGGAGATAGTTGAACATAAGAAAGGTGAAACCCCCTCAATCACTTTTAAGTGCCACAGTCATGATGGAGAGGAATGTTATCCTGGGGATATCACCGTTACTTCCACTTACACACTCACCTCAAGCACAACTCTGAGGCTTGACATGGAAGAAGTGCCTAAGGACAAGCCCACCATAGTTAACTTAGCTCAGCATACCTACTGGAACTTAGCTGGCCACAACTCAGGGAATATACTTGACCATTCAATTCACTTATGGGCTAATCATATCACGCCTGTGGACGAGAATACGGTGCCAACCGGTGAAATCATGCTAGTGAAGGGTACCCCTTTTGATTTTACATCTTTTAATAGAATAGGCAGCACCATTAGTCAGGTTGGACTGGGATATGACGACAATTATGTGCTTGATTGTGGGGAAGAGAAAGAGGGTTTGAGACATACTGCAAAAGTGAGGGATCCATCAAGTTCAAGAGTACTTAACTTGTGGACAAATGCCCCTGGTGTGCAATTTTACACTACAAACTATGTGAATGGTGTTCAAGGAAAAGGAGGTGCTATATATGGAAAGCATGTCGGGTTATGTCTCGAGATACAGGTGCTATATATGAAAAGGAGGTGTTATATATATATAGTTTAA

Predicted protein sequences of Glyma09g30534

Limit To All Plant Sequences

>Glyma09g30534.1   sequence type=predicted peptide   gene model=Glyma09g30534   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNFVCCFPDPLSPLQISGGNVGFDKKVWEIVEHKKGETPSITFKCHSHDGEECYPGDITVTSTYTLTSSTTLRLDMEEVPKDKPTIVNLAQHTYWNLAGHNSGNILDHSIHLWANHITPVDENTVPTGEIMLVKGTPFDFTSFNRIGSTISQVGLGYDDNYVLDCGEEKEGLRHTAKVRDPSSSRVLNLWTNAPGVQFYTTNYVNGVQGKGGAIYGKHVGLCLEIQVLYMKRRCYIYIV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain