Glyma09g30410 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g30410): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g30410): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g30410

Feature Type:	gene_model
Chromosome:	Gm09
Start:	37257112
stop:	37260697
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g30410

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G03860	AT	Annotation by Michelle Graham. TAIR10: prohibitin 2 \| chr1:979611-981157 REVERSE LENGTH=286	SoyBase	E_val: 1.00E-171	ISS
GO:0000741	GO-bp	Annotation by Michelle Graham. GO Biological Process: karyogamy	SoyBase	N/A	ISS
GO:0006511	GO-bp	Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009165	GO-bp	Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009560	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation	SoyBase	N/A	ISS
GO:0009853	GO-bp	Annotation by Michelle Graham. GO Biological Process: photorespiration	SoyBase	N/A	ISS
GO:0051788	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to misfolded protein	SoyBase	N/A	ISS
GO:0080129	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005747	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial respiratory chain complex I	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009536	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
KOG3090	KOG	Prohibitin-like protein	JGI		ISS
PTHR23222	Panther	PROHIBITIN	JGI		ISS
PF01145	PFAM	SPFH domain / Band 7 family	JGI		ISS
UniRef100_B9RVS2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Prohibitin, putative n=1 Tax=Ricinus communis RepID=B9RVS2_RICCO	SoyBase	E_val: 0	ISS
UniRef100_I1L437	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L437_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g30410

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g30410 not represented in the dataset	Glyma09g30410 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g30410 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g173500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g30410

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g30410

Limit To All Plant Sequences

>Glyma09g30410.1   sequence type=CDS   gene model=Glyma09g30410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATCTGAAGAACATGAAGGTTCCGAACGTTCCAGGTGGCGGGGGGATCTCTGCGCTGCTGAAGCTTGGGATTGTTGGTGGAATTGGTTTGTATGCTGCTGCTAACAGTCTCTACAATGTTGATGGAGGTCACCGAGCCATTGTTTTCAACCGTCTAGTTGGTGTCAAAGACAAGGTCTATCCTGAAGGAACTCACTTCATAATTCCGTGGTTTGAGAGGCCGGTTATCTATGATGTCCGTGCACGACCCCATCTAGTTGAGAGTACATCTGGGAGTCGTGATCTACAGATGGTGAAAATTGGACTTCGAGTTCTTACTCGCCCGTTGCCCAACCAATTACCTACGGTTTATCGGACCCTTGGAGAGAATTATAATGAAAGGGTTTTACCTTCAATCATACATGAAACTTTGAAAGCCGTGGTTGCCCAGTACAATGCCAGCCAGCTTATTACTCAGCGAGAGGCTGTTAGTCGGGAAATCCGGAAGATTTTGACTGAAAGGGCTGCTAACTTCAATATTGCCCTTGATGATGTGTCAATTACTAGTCTGACTTTTGGCAAGGAGTTTACTGCTGCAATTGAAGCAAAGCAGGTAGCTGCACAAGAAGCTGAGAGGGCTAAATTTGTTGTAGAAAAAGCTGAGCAAGACAAGAGAAGTGCTGTAATCAGAGCACAGGGAGAAGCAAAAAGTGCCCAACTAATTGGACAGGCTATTGCCAACAATCCAGCTTTTATCACATTGAGGAAGATAGAAGCTGCACGAGAGATTGCACATACCATATCAAACGCGGCAAACAAGGTTTACCTGAATTCAGATGATCTGCTGTTGAATCTTCAAAAGATGAATTTGGAGCCAGGCAGAAAGTGA

Predicted protein sequences of Glyma09g30410

Limit To All Plant Sequences

>Glyma09g30410.1   sequence type=predicted peptide   gene model=Glyma09g30410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNLKNMKVPNVPGGGGISALLKLGIVGGIGLYAAANSLYNVDGGHRAIVFNRLVGVKDKVYPEGTHFIIPWFERPVIYDVRARPHLVESTSGSRDLQMVKIGLRVLTRPLPNQLPTVYRTLGENYNERVLPSIIHETLKAVVAQYNASQLITQREAVSREIRKILTERAANFNIALDDVSITSLTFGKEFTAAIEAKQVAAQEAERAKFVVEKAEQDKRSAVIRAQGEAKSAQLIGQAIANNPAFITLRKIEAAREIAHTISNAANKVYLNSDDLLLNLQKMNLEPGRK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain