SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g29720): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g29720): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g29720

Feature Type:gene_model
Chromosome:Gm09
Start:36540972
stop:36548174
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g29720
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G48410AT Annotation by Michelle Graham. TAIR10: Stabilizer of iron transporter SufD / Polynucleotidyl transferase | chr1:17886285-17891892 REVERSE LENGTH=1048 SoyBaseE_val: 0ISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009850GO-bp Annotation by Michelle Graham. GO Biological Process: auxin metabolic process SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009880GO-bp Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009955GO-bp Annotation by Michelle Graham. GO Biological Process: adaxial/abaxial pattern specification SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010050GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative phase change SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010072GO-bp Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0010305GO-bp Annotation by Michelle Graham. GO Biological Process: leaf vascular tissue pattern formation SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0010589GO-bp Annotation by Michelle Graham. GO Biological Process: leaf proximal/distal pattern formation SoyBaseN/AISS
GO:0016246GO-bp Annotation by Michelle Graham. GO Biological Process: RNA interference SoyBaseN/AISS
GO:0016441GO-bp Annotation by Michelle Graham. GO Biological Process: posttranscriptional gene silencing SoyBaseN/AISS
GO:0016569GO-bp Annotation by Michelle Graham. GO Biological Process: covalent chromatin modification SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0035195GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by miRNA SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045087GO-bp Annotation by Michelle Graham. GO Biological Process: innate immune response SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0048830GO-bp Annotation by Michelle Graham. GO Biological Process: adventitious root development SoyBaseN/AISS
GO:0048864GO-bp Annotation by Michelle Graham. GO Biological Process: stem cell development SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0019898GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extrinsic to membrane SoyBaseN/AISS
GO:0004521GO-mf Annotation by Michelle Graham. GO Molecular Function: endoribonuclease activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0035197GO-mf Annotation by Michelle Graham. GO Molecular Function: siRNA binding SoyBaseN/AISS
GO:0035198GO-mf Annotation by Michelle Graham. GO Molecular Function: miRNA binding SoyBaseN/AISS
KOG1041 KOG Translation initiation factor 2C (eIF-2C) and related proteins JGI ISS
PTHR22891Panther EUKARYOTIC TRANSLATION INITIATION FACTOR 2C JGI ISS
PF02170PFAM PAZ domain JGI ISS
PF02171PFAM Piwi domain JGI ISS
PF08699PFAM Domain of unknown function (DUF1785) JGI ISS
UniRef100_B9SJV6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Eukaryotic translation initiation factor 2c, putative n=1 Tax=Ricinus communis RepID=B9SJV6_RICCO SoyBaseE_val: 0ISS
UniRef100_I1L3Y0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1L3Y0_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma09g29720
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g29720 not represented in the dataset
Glyma09g29720 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g29720
ParalogEvidenceComments
Glyma16g34300 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g29720 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g167100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g29720
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g29720
>Glyma09g29720.1   sequence type=CDS   gene model=Glyma09g29720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTCAGAAAGAGAAGAACTGAACTACCCAGTGGGGGTGAAAGCTCTGAGGCTCAACGCCCTGCTGAAAGGAGTGCACCACCCCAACAACAGGCTGCTGCTGCTGCCCCAGGAGGGGCTGGACCCCAAGGAGGCAGAGGTTGGGGTCCCCAAGGAGGACGAGGAGGCTATGGTGGGGGCCGCAGTCGTGGGATGCCCCAACAGCAATATGGTGCCCCTCCTGAATATCAAGGTAGGGGAAGGGGAGGGCCTTCTCAGCAAGGAGGCCGTGGAGGGTATGGCGGTGGCCGAAGTGGTGGTGGTATGGGCAGTGGCCGTGGCGTAGGTCCTTCATATGGTGGCCCATCCAGGCCACCGGCACCCGAGCTGCACCAAGCAACCTCAGTTCAATTCTATCAAACTGGGGTGAGTTCTCAGCCTGCATTATCTGAGGCCAGTTCATCACTGCCGCCGCCGGAACCTGTTGATTTGGAACAGTCAATGGCGCAGATGGTGCTTCATTCTGAAGCTGCTCCTTCTCCGCCTCCTGCAAGTAAATCATCAATGAGGTTCCCTCTTCGACCAGGAAAGGGTAGCTATGGCACCAAATGTGTTGTCAAGGCTAATCATTTCTTTGCCGAGTTGCCCAACAAAGATCTGCATCAATATGATGTAACAATTACTCCTGAAGTGACATCAAGAGGAGTGAACCGTGCTGTTATGGAGCAGTTGGTGAGGCTGTATCGGGAATCTCACTTGGGTAAGAGACTTCCTGCTTACGATGGGCGCAAGAGCCTCTATACTGCTGGACCACTTCCTTTTATGTCAAAGGAGTTCAGAATTGTTCTTGCTGATGATGATGAAGGAGCTGGAGGCCAGAGGAGGGACAGGGAATTCAAGGTTGTGATAAAATTGGCTGCACGGGCAGATCTTCACCATTTAGGACTCTTTTTACAGGGAAGGCAAACTGATGCTCCTCAAGAGGCTTTGCAGGTCCTTGACATTGTTCTGCGTGAACTCCCTACTACAAGGTATTGTCCTGTAGGAAGATCATTTTATTCACCTGATTTGGGTAGAAGACAGCCTTTAGGTGAGGGATTGGAAAGCTGGCGTGGTTTCTACCAGAGTATTCGGCCTACACAGATGGGGCTATCCCTGAACATTGATATGTCTTCCACTGCATTTATTGAGCCATTGCCGGTAATTGACTTCGTAAATCAACTGCTGAACAGAGATGTATCTGCCCGGCCATTATCTGATGCTGATCGTGTTAAGATCAAGAAAGCTCTTCGAGGTATCAAAGTTGAAGTAACACATCGTGGAAACATGAGAAGGAAATATCGTATCTCTGGTCTGACTTCACAGGCAACCAGAGAATTGACATTCCCAGTAGATGAAAGGGGAACCATGAAATCTGTTGTGGAGTACTTCTATGAGACATATGGGTTTGTCATTCAACATACTCAGTGGCCTTGTCTGCAAGTTGGCAATACACAGAGACCTAACTATTTGCCAATGGAGGTTTGCAAGATAGTGGAAGGTCAAAGGTACTCAAAAAGGCTTAATGAGAGGCAAATCACCGCTTTGCTGAAAGTTACATGCCAGCGTCCTGTTGAGAGGGAGCGTGATATCATGCAGACAGTACACCACAATGCATACCATGAAGATCCTTATGCCAAAGAATTTGGGATCAAGATCAGTGAGAAGCTTGCTCAAGTTGAAGCTCGCATCCTTCCTGCTCCATGGCTCAAATATCACGATACGGGCAGAGAAAAGGATTGTCTTCCTCAAGTTGGGCAATGGAATATGATGAATAAGAAAATGGTTAATGGGGGAACAGTTAACAACTGGTTCTGCATAAACTTTTCGAGGAATGTTCAAGATAGTGTTGCCCGCGGTTTTTGCTATGAACTTGCTCAGATGTGTTATATATCTGGAATGGCATTTACACCTGAGCCAGTAGTTCCCCCAGTCAGTGCTCGCCCTGATCAAGTGGAAAAGGTTCTTAAAACTCGGTATCACGATGCCAAGAATAAACTGCAAGGAAAAGAGCTTGATTTACTCATTGTTATCTTGCCGGATAATAATGGATCACTATATGGTGACCTCAAACGTATTTGTGAGACAGATCTAGGACTTGTTTCACAATGTTGCTTAACTAAGCATGTCTTCAAAATGAGCAAGCAGTACCTTGCAAATGTTGCTTTGAAAATTAATGTCAAAGTTGGAGGGAGAAACACTGTACTGGTTGATGCGCTCTCACGACGCATTCCCTTGGTCAGTGACAGACCTACAATTATTTTTGGAGCTGATGTGACTCATCCACATCCTGGAGAGGATTCAAGTCCATCAATTGCAGCAGTTGTGGCTTCGCAAGACTATCCTGAAATTACAAAGTATGCTGGTTTAGTTTGTGCCCAAGCTCATAGGCAGGAACTCATCCAGGATCTTTTCAAACAATGGCAAGATCCAGTCAGAGGAACAGTGACTGGTGGAATGATCAAGGAACTTCTTATATCTTTTAGGAGAGCTACAGGACAAAAGCCACAACGCATCATATTTTATAGGGATGGTGTTAGTGAGGGTCAATTTTATCAGGTTCTACTGTTTGAGCTTGATGCTATTCGAAAGGCATGTGCATCCCTGGAACCCAACTATCAGCCTCCTGTGACTTTTGTGGTGGTTCAAAAGCGTCACCACACAAGGCTCTTTGCCAGCAACCATCACGATAAGAGTTCTTTTGACAGGAGTGGCAACATATTGCCTGGTACTGTTGTTGACTCCAAAATCTGCCATCCCACCGAATTTGACTTTTATCTCTGCAGCCATGCTGGAATACAGGGTACAAGCCGTCCTGCTCACTACCATGTGTTGTGGGATGAAAACAATTTTACTGCTGATGCCTTGCAAACACTCACCAATAATCTTTGCTACACATATGCTCGGTGCACCCGATCTGTTTCAATTGTGCCTCCTGCATACTATGCTCACCTTGCTGCATTCCGTGCAAGGTTTTACATGGAACCCGAGACTTCGGATAGTGGCTCTATGACAAGTGGTGCTGTTGCAGGCCGTGGGATGGGTGGCGGCGGTGGTGGTGGTGTAGGGCGTAGCACCCGGGCACCTGGTGCTAATGCTGCTGTGAGACCATTGCCTGCACTCAAAGAGAACGTTAAGAGAGTTATGTTTTATTGTTAA
Predicted protein sequences of Glyma09g29720
>Glyma09g29720.1   sequence type=predicted peptide   gene model=Glyma09g29720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVRKRRTELPSGGESSEAQRPAERSAPPQQQAAAAAPGGAGPQGGRGWGPQGGRGGYGGGRSRGMPQQQYGAPPEYQGRGRGGPSQQGGRGGYGGGRSGGGMGSGRGVGPSYGGPSRPPAPELHQATSVQFYQTGVSSQPALSEASSSLPPPEPVDLEQSMAQMVLHSEAAPSPPPASKSSMRFPLRPGKGSYGTKCVVKANHFFAELPNKDLHQYDVTITPEVTSRGVNRAVMEQLVRLYRESHLGKRLPAYDGRKSLYTAGPLPFMSKEFRIVLADDDEGAGGQRRDREFKVVIKLAARADLHHLGLFLQGRQTDAPQEALQVLDIVLRELPTTRYCPVGRSFYSPDLGRRQPLGEGLESWRGFYQSIRPTQMGLSLNIDMSSTAFIEPLPVIDFVNQLLNRDVSARPLSDADRVKIKKALRGIKVEVTHRGNMRRKYRISGLTSQATRELTFPVDERGTMKSVVEYFYETYGFVIQHTQWPCLQVGNTQRPNYLPMEVCKIVEGQRYSKRLNERQITALLKVTCQRPVERERDIMQTVHHNAYHEDPYAKEFGIKISEKLAQVEARILPAPWLKYHDTGREKDCLPQVGQWNMMNKKMVNGGTVNNWFCINFSRNVQDSVARGFCYELAQMCYISGMAFTPEPVVPPVSARPDQVEKVLKTRYHDAKNKLQGKELDLLIVILPDNNGSLYGDLKRICETDLGLVSQCCLTKHVFKMSKQYLANVALKINVKVGGRNTVLVDALSRRIPLVSDRPTIIFGADVTHPHPGEDSSPSIAAVVASQDYPEITKYAGLVCAQAHRQELIQDLFKQWQDPVRGTVTGGMIKELLISFRRATGQKPQRIIFYRDGVSEGQFYQVLLFELDAIRKACASLEPNYQPPVTFVVVQKRHHTRLFASNHHDKSSFDRSGNILPGTVVDSKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADALQTLTNNLCYTYARCTRSVSIVPPAYYAHLAAFRARFYMEPETSDSGSMTSGAVAGRGMGGGGGGGVGRSTRAPGANAAVRPLPALKENVKRVMFYC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo