Glyma09g28040 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g28040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g28040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g28040

Feature Type:	gene_model
Chromosome:	Gm09
Start:	35026031
stop:	35029623
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g28040

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G25370	AT	Annotation by Michelle Graham. TAIR10: Double Clp-N motif protein \| chr4:12972747-12974580 FORWARD LENGTH=238	SoyBase	E_val: 5.00E-60	ISS
GO:0019538	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein metabolic process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009532	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid stroma	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0009579	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: thylakoid	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
PTHR11638	Panther	ATP-DEPENDENT CLP PROTEASE	JGI		ISS
PTHR11638:SF62	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF02861	PFAM	Clp amino terminal domain	JGI		ISS
UniRef100_I1L3K2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L3K2_SOYBN	SoyBase	E_val: 2.00E-126	ISS
UniRef100_Q93WL3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Double Clp-N motif protein n=2 Tax=Magnoliophyta RepID=Q93WL3_ARATH	SoyBase	E_val: 3.00E-57	ISS

Expression Patterns of Glyma09g28040

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g28040 not represented in the dataset	Glyma09g28040 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g28040 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g153200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g28040

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g28040

Limit To All Plant Sequences

>Glyma09g28040.1   sequence type=CDS   gene model=Glyma09g28040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCATTCCCAATCTCTCATCTTTCCTACCCACACTCTCCCATTCGAACCCAAACAACCAATGCACTCTCCCTCCAACCTCTCTCTTCGGCACCAGAATCACCCTCCTACGCGCCACCTCATCGTCCCGTTCCCTCCCCAACACAAGTTGCAGTGCCACGTCAGCAACCGTGTCGTTTAGCCTCCCCACCCCGAAACCCCTTTCGGATACGCCCGATAAAACCCCAAAGTGGTCGGAGAGGGCTATAAAATCGTATGCAATGGGGGAATTGGAAGCGAGGAAGCTCAAGTATCCAAACACGGGAACCGAGGCGATTCTCATGGGGATTTTGGTTGAAGGAACAAGTAATGCTGCAAAATTCTTAAGAGCTAATGGAATTACTCTTTTGAAAGCACGTGAAGAAACAGTAGAGCTACTTGGGAAATCTGATTTGTTTTTCTTCAGCCCTGAGCATCCTCCTTTGACTGAACCAGCCCAGAAAGCCCTTGATTGGGCAATTGAGGAGAAATTGAAGTCAGATCTTGGCTACTCTAGGTTTTGA

Predicted protein sequences of Glyma09g28040

Limit To All Plant Sequences

>Glyma09g28040.1   sequence type=predicted peptide   gene model=Glyma09g28040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASIPNLSSFLPTLSHSNPNNQCTLPPTSLFGTRITLLRATSSSRSLPNTSCSATSATVSFSLPTPKPLSDTPDKTPKWSERAIKSYAMGELEARKLKYPNTGTEAILMGILVEGTSNAAKFLRANGITLLKAREETVELLGKSDLFFFSPEHPPLTEPAQKALDWAIEEKLKSDLGYSRF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain