Glyma09g27550 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g27550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g27550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g27550

Feature Type:	gene_model
Chromosome:	Gm09
Start:	34401110
stop:	34401997
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g27550

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G62180	AT	Annotation by Michelle Graham. TAIR10: carboxyesterase 20 \| chr5:24978866-24979849 REVERSE LENGTH=327	SoyBase	E_val: 3.00E-21	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0016787	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity	SoyBase	N/A	ISS
PTHR23024	Panther	MEMBER OF 'GDXG' FAMILY OF LIPOLYTIC ENZYMES	JGI		ISS
PTHR23024:SF10	Panther	CARBOXYLESTERASE-RELATED	JGI		ISS
UniRef100_G7ID32	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: CXE carboxylesterase n=1 Tax=Medicago truncatula RepID=G7ID32_MEDTR	SoyBase	E_val: 6.00E-33	ISS
UniRef100_I1L3G8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L3G8_SOYBN	SoyBase	E_val: 4.00E-147	ISS

Expression Patterns of Glyma09g27550

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g27550 not represented in the dataset	Glyma09g27550 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g27550

Paralog	Evidence	Comments
Glyma16g32571	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g27550 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g149600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g27550

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g27550

Limit To All Plant Sequences

>Glyma09g27550.1   sequence type=CDS   gene model=Glyma09g27550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCGCCTCTTCTCTTTCCCACACTACAAATCCTTTTGGAGATCTTCAATTGCATTTGCATTTTTCTTAACATTTCTCACTCTCCAAACCCAATCCACTCCAATCCCATGCAACAAGGACCCCTACAAGGAGCTCAACCTTATCCCTAACAAAAACGGCACCGTCACGCGCCCCAACAAACCCCCCGAGAGCCCGCCCGCACCGGATCCCAACCTCAACACCCTCGTACTCTCCAAAGACATCTCCATCAACCAATCAAAAGGCACATGGGCGAGAGTCTACCTACCCCGCGTGGCACTGGATCACAGCTCCAAGCTCCCCTTATTGGTTTTCTACCATGGGGGAGGGTTCATTTTCCTCGGTGCGGCCTCAACAATCTTCCACAATTTTTGCTTCAACATGGCAAACGACGTCGTTGCGTCAGCTGATGCTGCGGTCACTCTAGAGGATCCCGCTGGTTACGGCTGTGGCGGTGACCACTTGTGGATCGGAGTGAGAGTTCTGGGGCATTTCACACCAGGGGATTATCATGGGGTTCAAGATAGTGACCCATTGAAGGCAAGGGAGCTATATGGGGTAATTAAAACTTTTATTTCAGCTTTAAATTAA

Predicted protein sequences of Glyma09g27550

Limit To All Plant Sequences

>Glyma09g27550.1   sequence type=predicted peptide   gene model=Glyma09g27550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRLFSFPHYKSFWRSSIAFAFFLTFLTLQTQSTPIPCNKDPYKELNLIPNKNGTVTRPNKPPESPPAPDPNLNTLVLSKDISINQSKGTWARVYLPRVALDHSSKLPLLVFYHGGGFIFLGAASTIFHNFCFNMANDVVASADAAVTLEDPAGYGCGGDHLWIGVRVLGHFTPGDYHGVQDSDPLKARELYGVIKTFISALN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain