Glyma09g27213 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g27213): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g27213): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g27213

Feature Type:	gene_model
Chromosome:	Gm09
Start:	33984760
stop:	33991658
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g27213

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G25450	AT	Annotation by Michelle Graham. TAIR10: non-intrinsic ABC protein 8 \| chr4:13009845-13013912 REVERSE LENGTH=714	SoyBase	E_val: 0	ISS
GO:0006200	GO-bp	Annotation by Michelle Graham. GO Biological Process: ATP catabolic process	SoyBase	N/A	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0035672	GO-bp	Annotation by Michelle Graham. GO Biological Process: oligopeptide transmembrane transport	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0015421	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oligopeptide-transporting ATPase activity	SoyBase	N/A	ISS
GO:0016887	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATPase activity	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
GO:0042626	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of substances	SoyBase	N/A	ISS
KOG0058	KOG	Peptide exporter, ABC superfamily	JGI		ISS
PTHR24221	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24221:SF71	Panther		JGI		ISS
PF00005	PFAM	ABC transporter	JGI		ISS
PF00664	PFAM	ABC transporter transmembrane region	JGI		ISS
UniRef100_G7ZX38	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: ABC transporter B family member n=1 Tax=Medicago truncatula RepID=G7ZX38_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233877C	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233877C related cluster n=1 Tax=unknown RepID=UPI000233877C	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g27213

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g27213 not represented in the dataset	Glyma09g27213 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g27213 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g147400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g27213

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g27213

Limit To All Plant Sequences

>Glyma09g27213.1   sequence type=CDS   gene model=Glyma09g27213   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCTGCAACAACAACAACACTCTCTCACCATCATCACCTTCCTCTCCTCCTTCATTCTCCTCTTTCCATCAAATTTACCAAACCGCCCCTCTCTCTTTCCCTCTCGCGACGCCCCCTTCTAACGAACCCTCTCCACGCGCGCTTCCTCCTCCCTCCGCCACGCGCCTACGCCGCCGCGCCCGCGTCCGACCCGAATTTCGCCGACCCCGATCCGAAACTCGCCGGGTCGGACCCGGAGAACGCGAGGCCACGGAATGTCATCACGTGGAGCCTCCTCTGCACGCTCCTCATGAAGCACAAGCTGCGCCTCGCCCTCGCGGTCGCAACGCTCTTCGCCTGCTCCACCTGTACCCTATCCATGCCCATCTTTTCCGGACGGTTTTTTGAAGTTCTAATTGGCACTAGACCTGAGCCGTTATGGAAGCTGCTTAGTAAAATTGGAGTTCTGTATGCCCTGGAGCCACTTTTGACTATTATTTTTGTTATAAACATGAACATAGTGTGGGAGAAAATTATGTCAACACTAAGAGCTCAGATCTTTGGAAGAATATTGATTCAAAAGATTGAATTTTTTGACAAATACAAGGTTGGTGAACTCACAGGTTTGCTAACATCTGATTTGGGTTCTCTTAAAAATATAGTCAGTGAGAATGTCTCAAGGGATCGCGGATTCAGAGCATTATCTGAGGTCATTGGAACAATATTCATACTTTTTTCTTTATCCCCACAACTGGCACCCATTCTGGGTGTTCTGATGCTCGCAGTTTCCATTTCAATTGCTGTCTACAAGAGATCTACTTTGCCGGTTTTTAAAGCACATGGGATGGTCCAAGCATCTATATCTGATTGTGTAACAGAAACATTTTCTGCTATTCGAACAGTAAGATCATTTGGGGGTGAAAAGCGCCAGATGTTCACATTTGCTAACCAGGTTCTATCTTTCCAATCAAGTGGGATAAAGCTTGGAACTTTCAAATCTGTAAATGAGTCCTTGACTAGAGTTGCTGTTTATATTTCTTTAATAGCATTGTATTGTCTTGGAGGAAGCAAGGTTAAGGCGGGTGAGCTCTCTGTTGGAACCATGGCATCTTTTATTGGATATACTTTCACTTTAACATTCGCTGTTCAAGGATTGGTTAACACTTTTGGAGATCTTCGTGGAACTTTTGCTGCTGTTGAGAGGATCAACTCTGTTTTATCTGGAGCTCAAGTTGATGATGCCCTTGCCTATGGCTTAGAAAGAGAACTGAGACAAAAAACACTGGATGATGAAAACTATAAATTGATCTTATCAAATATTTCTACTGAGAATAACCAAAAACATTATTTGCATTACATGTCAGCTCTCAAAACATCAAGCAATTTGTTTAGCTTAGCATGGTCTGGAGATATTTGTCTTGAAGATGTATATTTCTCCTATCCTTTAAGGCCAGATGTGGAAATCTTGCGTGGCTTAAATTTAAGACTAAAATTTGGAACTGTAACTGCACTGGTCGGTCCTAGTGGTGCAGGCAAAAGTACTGTAGTACAGCTATTATCTCGTTTTTATGAGCCAACAAGTGGCTGTATAACAGTTGCAGGAGAGGATGTCCGAACATTTGATAAGAGTGAATGGGCTCGGGTTGTATCGATTGTAAATCAAGAGCCTGTTCTGTTTTCGGTTTCTGTTGGGGAAAATATTGCATATGGGCTTCCTGATGAAGATGTTTCTAAAGAAGATGTGATTAAGGCAGCGAAAGCTGCAAATGCTCATGACTTTATAATTTCACTTCCACAGGGCTATGATACACTTGTTGGTGAGCGTGGAGGCCTACTGAGTGGAGGACAAAGACAGAGAATTGCTATTGCCCGGGCTCTCCTAAAGAATGCTCCTATCCTTATACTTGATGAGGCTACCAGTGCCCTTGATGCTGTCAGTGAGCGATTGGTCCAGGATGCTCTCAACCATCTGATGAAGGGAAGGACAACATTAGTAATAGCACATCGATTAAGCACAGTCCAAAATGCATATCAAATTGCACTCTGTTCTGAGGGGCGGATTGCAGAACTAGGCACCCATTTTGAGTTATTGGCTAAGAAAGGCCAATATGCTTCACTGGTTGGCACACAAAGGCTTGCATTTGAATAA

Predicted protein sequences of Glyma09g27213

Limit To All Plant Sequences

>Glyma09g27213.1   sequence type=predicted peptide   gene model=Glyma09g27213   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASATTTTLSHHHHLPLLLHSPLSIKFTKPPLSLSLSRRPLLTNPLHARFLLPPPRAYAAAPASDPNFADPDPKLAGSDPENARPRNVITWSLLCTLLMKHKLRLALAVATLFACSTCTLSMPIFSGRFFEVLIGTRPEPLWKLLSKIGVLYALEPLLTIIFVINMNIVWEKIMSTLRAQIFGRILIQKIEFFDKYKVGELTGLLTSDLGSLKNIVSENVSRDRGFRALSEVIGTIFILFSLSPQLAPILGVLMLAVSISIAVYKRSTLPVFKAHGMVQASISDCVTETFSAIRTVRSFGGEKRQMFTFANQVLSFQSSGIKLGTFKSVNESLTRVAVYISLIALYCLGGSKVKAGELSVGTMASFIGYTFTLTFAVQGLVNTFGDLRGTFAAVERINSVLSGAQVDDALAYGLERELRQKTLDDENYKLILSNISTENNQKHYLHYMSALKTSSNLFSLAWSGDICLEDVYFSYPLRPDVEILRGLNLRLKFGTVTALVGPSGAGKSTVVQLLSRFYEPTSGCITVAGEDVRTFDKSEWARVVSIVNQEPVLFSVSVGENIAYGLPDEDVSKEDVIKAAKAANAHDFIISLPQGYDTLVGERGGLLSGGQRQRIAIARALLKNAPILILDEATSALDAVSERLVQDALNHLMKGRTTLVIAHRLSTVQNAYQIALCSEGRIAELGTHFELLAKKGQYASLVGTQRLAFE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain