Glyma09g24440 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g24440

Feature Type:	gene_model
Chromosome:	Gm09
Start:	30160045
stop:	30168165
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g24440

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G25720	AT	Annotation by Michelle Graham. TAIR10: glutaminyl cyclase \| chr4:13099929-13102470 REVERSE LENGTH=320	SoyBase	E_val: 5.00E-105	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0017186	GO-bp	Annotation by Michelle Graham. GO Biological Process: peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0016603	GO-mf	Annotation by Michelle Graham. GO Molecular Function: glutaminyl-peptide cyclotransferase activity	SoyBase	N/A	ISS
PF05096	PFAM	Glutamine cyclotransferase	JGI		ISS
UniRef100_I1L317	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L317_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_O81226	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Glutamine cyclotransferase n=1 Tax=Carica papaya RepID=O81226_CARPA	SoyBase	E_val: 3.00E-110	ISS

Expression Patterns of Glyma09g24440

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g24440 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g131800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g24440

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g24440

Limit To All Plant Sequences

>Glyma09g24440.1   sequence type=CDS   gene model=Glyma09g24440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCTTCCGCATTCCTTTCCGTTTATCTCATTATCTCCGTCATCGTCCTTTTGTCGAACAGGTGCTGCGCGTTTCAATGCGGGGTTTCCTACGACACGATCACCGTCCTCAACGCGTTCCCTCACGACCCACAAGCCTTCACTGAGGGTCTTCTTTATCATGGAAATGACACCTTATTTGAGTCAACTGGCCTTTATGGGGAGTCATCCGTCCGTAAAGTTGCTCTTCGTACTGGGAAGGTTGAGAATATTCAGAAGATGGATGATTCTTTATTTGGTGAAGGCTTAGCTCTCCTCAATAATAGGCTGTTCCAGCTAAATTGGTTGCAGAAAGATGGTTTCATATATGAGCCAAAAAATTTAAGCCAAATAGGGACATTTAAATATGATATGAAAGAGGGTTGGGGTCTGGCAACTGATGGAAAAGTCTTGTTTGGAAGTGATGGCAGTTCAACATTGTATCAATTTGAGCCTCAACCATTTAAAGTTGTATCAAAACAAGTTGTTTACTACAAGGGTCATCAAGTGCACAATCTCAATGAATTGGAATACATAAATGGTGAAGTTTGGGCCAATGTTTTGCCGACTGACTGCATTGTAAGAATCTCTCCCCATGATGGAAGGGTTCTTGGATGGATTCTCCTCCAAAATTTGAGGAAAGAACTTGTGGAAGCTGGGGAGATTAGTGATCGTGATATTTTGAATGGGATAGCATGGGATGGTGAGCAGAATCGTATTTTTGTGACTGGAAAACAATGGCCAAAGCTGTATGAAATCAAGGTTTCACCTATAAAGAAACCAATTGAAGAAGGGATCATCGAGCAACTTTGCTTGTATGAGCCTTTGAATGGGGGATTTGTGTTGGCTGACCCAGCCCAAAGAGAATGA

Predicted protein sequences of Glyma09g24440

Limit To All Plant Sequences

>Glyma09g24440.1   sequence type=predicted peptide   gene model=Glyma09g24440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSAFLSVYLIISVIVLLSNRCCAFQCGVSYDTITVLNAFPHDPQAFTEGLLYHGNDTLFESTGLYGESSVRKVALRTGKVENIQKMDDSLFGEGLALLNNRLFQLNWLQKDGFIYEPKNLSQIGTFKYDMKEGWGLATDGKVLFGSDGSSTLYQFEPQPFKVVSKQVVYYKGHQVHNLNELEYINGEVWANVLPTDCIVRISPHDGRVLGWILLQNLRKELVEAGEISDRDILNGIAWDGEQNRIFVTGKQWPKLYEIKVSPIKKPIEEGIIEQLCLYEPLNGGFVLADPAQRE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain