Glyma09g24080 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g24080

Feature Type:	gene_model
Chromosome:	Gm09
Start:	29732934
stop:	29734454
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g24080

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G52830	AT	Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 27 \| chr5:21410996-21412218 FORWARD LENGTH=348	SoyBase	E_val: 2.00E-50	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007263	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitric oxide mediated signal transduction	SoyBase	N/A	ISS
GO:0009739	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF03106	PFAM	WRKY DNA -binding domain	JGI		ISS
UniRef100_G7IDY1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: WRKY transcription factor n=1 Tax=Medicago truncatula RepID=G7IDY1_MEDTR	SoyBase	E_val: 3.00E-80	ISS
UniRef100_UPI00023382DE	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI00023382DE related cluster n=1 Tax=unknown RepID=UPI00023382DE	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma09g24080

Locus	Gene Symbol	Protein Name
	WRKY119	WRKY Transcription Factor

Expression Patterns of Glyma09g24080

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g24080

Paralog	Evidence	Comments
Glyma16g29561	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g24080 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g129100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g24080

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g24080

Limit To All Plant Sequences

>Glyma09g24080.2   sequence type=CDS   gene model=Glyma09g24080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACTCATGAGGATTGGGATCTCTTTGCCATCGTTAGAAGTTGCAAAGCTGCTACATTTACTGCCACCACAAACACAGAAACCCCACCCACCACTACCACCACCACCACCTCCAACACTACCTCTTGCTCGGGTTTGAGCCAAGAAAATGGCTCATTCTCTTTTCCCAATCTGGTGCAACCAACAACCAATGGGTTCCAAGAGCTTCAACACCAACAATTGTTAATAAACTTCAACCCCACCAACACCATTACTAGCACTAGCACTAGCACTAGTGGCCTTGGCATCAATCCCAATTCCACGTTTTCTGAAGTTGCGGGATTCATTGGACAACAGCAGATACAGCAAAGTCTCCACCACCATCTCGTTCCTGCTCCCACAAATCACACCTTCATTGGAACACCCTCCACTACTGGTTTTGACAGGTTCCAACAACAGCAACTCCAAACCCCAGAACAACAGCAACCACAGCAAAACCAACCACCCCTTCAAGCACCACAAACAAGTCACATCCTTTCACCAACCACACAACCACAAACACCCAGATCAAGAAAAAGAAAGAGCCAGCAGAAGAAAATGGTATGCCATGTAACCGCACAAAACCTCTCATCAGACTTGTGGGCATGGCGAAAATATGGACAAAAACCCATCAAAGGCTCTCCATATCCAAGGAACTATTACAGATGCAGTAGCTGCAAAGGATGCGCTGCGAGAAAGCAAGTAGAGCGAAGCACCAGCGAACCCAACACGTTCATCGTGACCTACACCGGCGACCACAAACACGCGAAACCCGTTCACCGGAACTCCCTCGCCGGCAACACCAGAACAAAACTATCCACCACCCGTTTACCCGAAACCCATGAAACCGTGTCTTGTGTAATAATAGAAAACGCATGCTCTTCAAACTCTGAGCTTTCTCCCATGTCGGTAAGGTCCGACACGCTGGAAAACGAGGCAACGCTCGTACCCGGCGAACCCGATTGCCCGGACACGGATATTGACCCTGAGGTGCCCTCTGAAGAAGACGAAGACGTTTTGATACCCAACACAGGTGCCATGTCAGACTCGATTTTCTTGGGGTTGACCAATTTTGACCGCGACGGCGTTTCCACGCTTTAA

Predicted protein sequences of Glyma09g24080

Limit To All Plant Sequences

>Glyma09g24080.2   sequence type=predicted peptide   gene model=Glyma09g24080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTHEDWDLFAIVRSCKAATFTATTNTETPPTTTTTTTSNTTSCSGLSQENGSFSFPNLVQPTTNGFQELQHQQLLINFNPTNTITSTSTSTSGLGINPNSTFSEVAGFIGQQQIQQSLHHHLVPAPTNHTFIGTPSTTGFDRFQQQQLQTPEQQQPQQNQPPLQAPQTSHILSPTTQPQTPRSRKRKSQQKKMVCHVTAQNLSSDLWAWRKYGQKPIKGSPYPRNYYRCSSCKGCAARKQVERSTSEPNTFIVTYTGDHKHAKPVHRNSLAGNTRTKLSTTRLPETHETVSCVIIENACSSNSELSPMSVRSDTLENEATLVPGEPDCPDTDIDPEVPSEEDEDVLIPNTGAMSDSIFLGLTNFDRDGVSTL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain