SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g22455): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g22455): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g22455

Feature Type:gene_model
Chromosome:Gm09
Start:27691716
stop:27698113
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g22455
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G70670AT Annotation by Michelle Graham. TAIR10: Caleosin-related family protein | chr1:26644830-26645970 FORWARD LENGTH=195 SoyBaseE_val: 3.00E-78ISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009819GO-bp Annotation by Michelle Graham. GO Biological Process: drought recovery SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
PF05042PFAM Caleosin related protein JGI ISS
UniRef100_B9SJ16UniRef Annotation by Michelle Graham. Most informative UniRef hit: Calcium ion binding protein, putative n=1 Tax=Ricinus communis RepID=B9SJ16_RICCO SoyBaseE_val: 1.00E-80ISS
UniRef100_UPI000152A1A6UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000152A1A6 related cluster n=1 Tax=unknown RepID=UPI000152A1A6 SoyBaseE_val: 7.00E-119ISS

Expression Patterns of Glyma09g22455
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g22455 not represented in the dataset
Glyma09g22455 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g22455 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g124400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g22455
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g22455
>Glyma09g22455.1   sequence type=CDS   gene model=Glyma09g22455   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAATTGTATGATAATGATTTGATTGGAGTAGCTGGTGGTGTTGGGGAGAATCCCATTCCACTTCAAGAAAACATTCTGCAGAAGCATGCTGCATTCTTTGACAAGAATCACGATGGTGTTATTTACCCATGGGAGACTTTTCAAGGCTTACGTGAAATTGGGAATGGGATCTTGGCTTCCTTTGGACTTTCTCTTTTCATCAATTTGGCTCTTAGTCAATCCACTCGTCCAGGAAAGTTTCCATCTTTTCTTTTCCCAATCGAAATTAAGAATATACAACTCGGCAAACATGGCAGTGACACTGGAGTCTATGATACTGAAGGAAGGTTTGTTCCTTCAAAATTTGAAGAAATTTTCACAAAACATGCACATACTCATCCAAATGCTTTAACATATGATGAGCTGAAGGAGATGTTAAAGGCAAACAGAGAGACAAAAGATTTGAAAGGAAGGATTGGTGGTGAGGTTGAATGGAAATTCCTTTACAAACTTGCCAAAGATAAGAATGGCTTACTACAGAAGGAAACAATCCGTGGTGTTTATGATGGAAGCGTGTTTGAACTGTTGAAAAAGGAACATTCTTCAAGCAAAAAGAAGTAA
Predicted protein sequences of Glyma09g22455
>Glyma09g22455.1   sequence type=predicted peptide   gene model=Glyma09g22455   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MELYDNDLIGVAGGVGENPIPLQENILQKHAAFFDKNHDGVIYPWETFQGLREIGNGILASFGLSLFINLALSQSTRPGKFPSFLFPIEIKNIQLGKHGSDTGVYDTEGRFVPSKFEEIFTKHAHTHPNALTYDELKEMLKANRETKDLKGRIGGEVEWKFLYKLAKDKNGLLQKETIRGVYDGSVFELLKKEHSSSKKK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo