Glyma09g21685 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g21685): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g21685): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g21685

Feature Type:	gene_model
Chromosome:	Gm09
Start:	26718339
stop:	26719618
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g21685

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G31530	AT	Annotation by Michelle Graham. TAIR10: SecY protein transport family protein \| chr2:13427060-13430308 FORWARD LENGTH=575	SoyBase	E_val: 1.00E-60	ISS
GO:0006354	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009306	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein secretion	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0015031	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein transport	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009526	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid envelope	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0015450	GO-mf	Annotation by Michelle Graham. GO Molecular Function: P-P-bond-hydrolysis-driven protein transmembrane transporter activity	SoyBase	N/A	ISS
PTHR10906	Panther	SECY/SEC61-ALPHA FAMILY MEMBER	JGI		ISS
PTHR10906:SF2	Panther	PROTEIN TRANSLOCASE SECY SUBUNIT	JGI		ISS
PF00344	PFAM	eubacterial secY protein	JGI		ISS
UniRef100_B9GSP6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: SecY protein n=1 Tax=Populus trichocarpa RepID=B9GSP6_POPTR	SoyBase	E_val: 6.00E-60	ISS
UniRef100_UPI0002336C46	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002336C46 related cluster n=1 Tax=unknown RepID=UPI0002336C46	SoyBase	E_val: 1.00E-63	ISS

Expression Patterns of Glyma09g21685

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g21685 not represented in the dataset	Glyma09g21685 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g21685 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g121400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g21685

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g21685

Limit To All Plant Sequences

>Glyma09g21685.1   sequence type=CDS   gene model=Glyma09g21685   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTCTTACATGTGGATTGTGTACAGGATAACATGCCAAAGGAAATTGCTGACTATTTAAATAAGATGGGTGCGAGAATACCAAACATAAAGCCTGGGAAGGCTACCATAGAGTACCTCTCCAAGGTTCAGGCATCCACACGATTTTGGGGGGGGCTATTGTTAAGTGTTCTGGCCACTGCATCAAGCGTTCTTGACCACTATTTGCGGCGTGTCAATGCTGGATTTGCTATTGGTTTTACATCAGTTCTAATTATTGTTGGTTCCATTATTGAACTCAGAAGATCATATCAAGCATATAATGTGATGCCAAGCTTGAGCAATGCTTTGAGACGATATGGCGTATAA

Predicted protein sequences of Glyma09g21685

Limit To All Plant Sequences

>Glyma09g21685.1   sequence type=predicted peptide   gene model=Glyma09g21685   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLHVDCVQDNMPKEIADYLNKMGARIPNIKPGKATIEYLSKVQASTRFWGGLLLSVLATASSVLDHYLRRVNAGFAIGFTSVLIIVGSIIELRRSYQAYNVMPSLSNALRRYGV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain