SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g20580): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g20580): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g20580

Feature Type:gene_model
Chromosome:Gm09
Start:25483970
stop:25489635
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g20580
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G70940AT Annotation by Michelle Graham. TAIR10: Auxin efflux carrier family protein | chr1:26743170-26745871 FORWARD LENGTH=640 SoyBaseE_val: 0ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0008356GO-bp Annotation by Michelle Graham. GO Biological Process: asymmetric cell division SoyBaseN/AISS
GO:0008361GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell size SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009606GO-bp Annotation by Michelle Graham. GO Biological Process: tropism SoyBaseN/AISS
GO:0009630GO-bp Annotation by Michelle Graham. GO Biological Process: gravitropism SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0009958GO-bp Annotation by Michelle Graham. GO Biological Process: positive gravitropism SoyBaseN/AISS
GO:0010015GO-bp Annotation by Michelle Graham. GO Biological Process: root morphogenesis SoyBaseN/AISS
GO:0010082GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of root meristem growth SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0010315GO-bp Annotation by Michelle Graham. GO Biological Process: auxin efflux SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0040007GO-bp Annotation by Michelle Graham. GO Biological Process: growth SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0048766GO-bp Annotation by Michelle Graham. GO Biological Process: root hair initiation SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009986GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell surface SoyBaseN/AISS
GO:0012506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vesicle membrane SoyBaseN/AISS
GO:0016328GO-cc Annotation by Michelle Graham. GO Cellular Compartment: lateral plasma membrane SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0009672GO-mf Annotation by Michelle Graham. GO Molecular Function: auxin:hydrogen symporter activity SoyBaseN/AISS
PF03547PFAM Membrane transport protein JGI ISS
UniRef100_I1L2S6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L2S6_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q8GV76UniRef Annotation by Michelle Graham. Most informative UniRef hit: Auxin efflux carrier protein n=1 Tax=Medicago truncatula RepID=Q8GV76_MEDTR SoyBaseE_val: 0ISS

Expression Patterns of Glyma09g20580
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g20580 not represented in the dataset
Glyma09g20580 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g20580 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g117900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g20580
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g20580
>Glyma09g20580.1   sequence type=CDS   gene model=Glyma09g20580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATAACGTGGAAAGACCTATACATGGTCTTGACCGCAGTGGTCCCACTCTACGTGGCGATGATCCTGGCGTACGGTTCGGTTCGGTGGTGGAAGATCTTCTCACCGGACCAGTGCTCCGGCATAAACCGTTTTGTCGCGATCTTCGCCGTGCCGCTCCTCTCCTTCCACTTCATCTCCACCAACAACCCCTACGCCATGAACTTCCGCTTCATCGCCGCCGACACGCTCCAGAAAATCATCATGCTCTTCGCCCTAGCAATCTGGACCAACCTCACCAAAACCGGTTCGCTAGAGTGGATGATCACCATCTTCTCCCTCTCCACGCTCCCCAACACCCTAGTCATGGGAATCCCTCTCCTAATCGCAATGTACGGCGAATATTCCGGTTCTCTCATGGTTCAAGTCGTGGTTCTTCAGTGCATCATATGGTACACCTTGTTACTCTTCTTATTCGAATACCGTGCCGCGAAGATCCTGATCATGGAACAGTTCCCTGAAACGGCAGCCTCCATTGTGTCGTTTAAGGTCGACTCCGACGTCGTTTCGCTCGACGGAAGAGACTTCTTGGAAACAGATGCTGAAGTCGGTGATGATGGGAAGCTTCATGTCACCGTTAGAAAATCGAACGCTTCACGGAGGTCGTTTATGATGACGCCGAGGCCGTCTAATCTCACCGGGGCGGAGATTTACAGCCTCAGCTCGTCTCGTAACCCAACGCCACGTGGCTCCAACTTTAACCATGCGGATTTTTTTTCCATGATGGGGTACCAGCCTCGCCACTCGAATTTCACCGCCAATGATTTGTTCTCTTCGCGTGGACCCACTCCGAGACCTTCGAATTTCGAAGAAAGCTCTATGCCTCAGGCGGCGACTGTAGCTTCTCCTCGGTTTGGGTTTTACCCGAGCCAGACCGTGCCCGCTTCGTACCCGCCTCCGAACCCAGAGTTTTCCTCCTCTACTAAACATTTGAAGAGCCAGAGTCAGAATTCGCTGACTCCAGCAAATGGGGCCCACGATGCGAAGGAGCTCCACATGTTTGTATGGAGCTCCAGCGCCTCGCCAGTGTCGGAGAACGCCGGACTCAACGTCTTCGGCAACACGGAACTCGGAACCTCCCAACAGCCTGACCAGGGTGGTGCTAAAGAGATTAGGATGTTGGTGGCTGATAATCATGCACACTTGCAAAATGGGGAAGCCAACAACAAAGGTGGTTTGGAGGCCGGACTTGATGTGGAAGAGTTCAAGTTTCCGGTAAATGGGGGAGAACAAGTGGAGGAAGAAAAAGAGAAAGAAAAAGAAGGGCTCAATAATGGACTCAACAAGTTGGGCTCAAGCTCCACGGCAGAGCTCCACCCGAAAGCCGCCGGAGCTGCTGAGGCTCCCGCCAGTAAACACATGCCTCCGGCGAGTGTCATGACTCGTCTCATACTCATCATGGTCTGGAGAAAGCTTATCCGCAATCCCAACACCTACTCTAGCCTAATTGGTGTAGTATGGTCCCTCATTGCATTCAGGTGGCACGTGCATATGCCCAAAATAATAGAGAAATCAATTTCGATACTGTCTGATGCTGGTCTTGGAATGGCTATGTTCAGCTTAGGTCTGTTTATGGCACTTCAACCCAAGATAATAGCATGTGGGAACTCTGTGGCTACATTTGCCATGGCTATTAGATTCCTCACTGGTCCAGCAGTTATGGCTGCAGCTTCCATAGCAGTTGGCCTTCGTGGCACCCTCCTACACGTTGCTATTGTTCAGGCTGCACTTCCTCAAGGGATTGTTCCATTTGTGTTTGCTAAGGAGTACAATGCCCATCCAGCCATTCTTAGTACAGCGGTTATATTTGGGATGTTGATAGCCCTTCCAATTACTTTGGTCTACTACATACTCCTTGGTTTATAA
Predicted protein sequences of Glyma09g20580
>Glyma09g20580.1   sequence type=predicted peptide   gene model=Glyma09g20580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MITWKDLYMVLTAVVPLYVAMILAYGSVRWWKIFSPDQCSGINRFVAIFAVPLLSFHFISTNNPYAMNFRFIAADTLQKIIMLFALAIWTNLTKTGSLEWMITIFSLSTLPNTLVMGIPLLIAMYGEYSGSLMVQVVVLQCIIWYTLLLFLFEYRAAKILIMEQFPETAASIVSFKVDSDVVSLDGRDFLETDAEVGDDGKLHVTVRKSNASRRSFMMTPRPSNLTGAEIYSLSSSRNPTPRGSNFNHADFFSMMGYQPRHSNFTANDLFSSRGPTPRPSNFEESSMPQAATVASPRFGFYPSQTVPASYPPPNPEFSSSTKHLKSQSQNSLTPANGAHDAKELHMFVWSSSASPVSENAGLNVFGNTELGTSQQPDQGGAKEIRMLVADNHAHLQNGEANNKGGLEAGLDVEEFKFPVNGGEQVEEEKEKEKEGLNNGLNKLGSSSTAELHPKAAGAAEAPASKHMPPASVMTRLILIMVWRKLIRNPNTYSSLIGVVWSLIAFRWHVHMPKIIEKSISILSDAGLGMAMFSLGLFMALQPKIIACGNSVATFAMAIRFLTGPAVMAAASIAVGLRGTLLHVAIVQAALPQGIVPFVFAKEYNAHPAILSTAVIFGMLIALPITLVYYILLGL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo