Report for Sequence Feature Glyma09g17151
Feature Type: gene_model
Chromosome: Gm09
Start: 20868257
stop: 20869690
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma09g17151
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G58000 AT
Annotation by Michelle Graham. TAIR10: VQ motif-containing protein | chr3:21474950-21475477 FORWARD LENGTH=175
SoyBase E_val: 6.00E-28 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PF05678 PFAM
VQ motif
JGI ISS
UniRef100_D7LVY8 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: VQ motif-containing protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7LVY8_ARALL
SoyBase E_val: 2.00E-25 ISS
UniRef100_UPI00023382FD UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI00023382FD related cluster n=1 Tax=unknown RepID=UPI00023382FD
SoyBase E_val: 2.00E-148 ISS
Expression Patterns of Glyma09g17151
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma09g17151
Paralog Evidence Comments
Glyma02g29281 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma09g17151 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.09g111800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma09g17151
Coding sequences of Glyma09g17151
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma09g17151.1 sequence type=CDS gene model=Glyma09g17151 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAAAACATGAGGCTCATGAGGAAACACAACACTACTCACACATGCATGGCCAATAATTCACACACACCTTCTTCTTCCCTAGCCATGCACAAAGGTTCCCACATGATATCCAAAACCAAACCAAAGATTCGCATAATCCACATATTTGCACCCGAGATCATAAAAACGGATGTGGAGAACTTCAGGGAGCTTGTGCAGAAGCTAACTGGGAAACCAAGTGGAGAAAATTTGAAGTACTTTTGCAACAACAAGAAGAACAAGGCAATTGCAAGAACAAGGGTTGTGGCAAAAAGAGAGGAATTAGAATCTTATTCGAGTGAGAGTGGCATGTCAGAGGATCATCACAACAACACAGTGAAAATTAATAATAATAACAATAATAATAACAATGGTGGGTATTGTTGGGGATTGGATGTGACAATAAGAGACAAAGTCAAAGAAGAGGTTAATGGGGTTTGTTGCAGTGATGATCAAAGTAATTCTTCTGGAGGATACTTGGGTGGGTTCTCTGATTTGGAAGGGTTCATTTCTGAGATTGGTGGGTTTCCTTTGCTTCCTTTGGATGGGAATCACATGATGCAAGGGTTAGAAGAATCTCAGCTTCTATAG
Predicted protein sequences of Glyma09g17151
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma09g17151.1 sequence type=predicted peptide gene model=Glyma09g17151 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MENMRLMRKHNTTHTCMANNSHTPSSSLAMHKGSHMISKTKPKIRIIHIFAPEIIKTDVENFRELVQKLTGKPSGENLKYFCNNKKNKAIARTRVVAKREELESYSSESGMSEDHHNNTVKINNNNNNNNNGGYCWGLDVTIRDKVKEEVNGVCCSDDQSNSSGGYLGGFSDLEGFISEIGGFPLLPLDGNHMMQGLEESQLL*