Glyma09g17020 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g17020

Feature Type:	gene_model
Chromosome:	Gm09
Start:	20745409
stop:	20753988
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g17020

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G42080	AT	Annotation by Michelle Graham. TAIR10: Chaperone DnaJ-domain superfamily protein \| chr2:17553409-17555475 REVERSE LENGTH=263	SoyBase	E_val: 4.00E-41	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0031072	GO-mf	Annotation by Michelle Graham. GO Molecular Function: heat shock protein binding	SoyBase	N/A	ISS
PTHR25040	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR25040:SF104	Panther		JGI		ISS
PF00226	PFAM	DnaJ domain	JGI		ISS
UniRef100_B9SXJ3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Heat shock protein binding protein, putative n=1 Tax=Ricinus communis RepID=B9SXJ3_RICCO	SoyBase	E_val: 5.00E-64	ISS
UniRef100_I1L2L6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L2L6_SOYBN	SoyBase	E_val: 5.00E-113	ISS

Expression Patterns of Glyma09g17020

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g17020

Paralog	Evidence	Comments
Glyma02g29150	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g17020 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g111100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g17020

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g17020

Limit To All Plant Sequences

>Glyma09g17020.2   sequence type=CDS   gene model=Glyma09g17020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACAAGAGCATCTTCACCAAACTCTTTCATTCTACTTCTCTCTTGGAACGCAAACCCCGCGCTTTTGGAGAATCTGTTAGTTCCTTGAACAACTCCTTCTGGAAAGAAGATGATGATGAGGATGGTCCATCTCCCAGTCAAGGCCCCTCATGGTTCAGAAAACAATATTCTCCTAAAGGCTCTGGAAGGCACATTGTTGAAAAGAAGATTATGGTTATATATGGTTTGTTCTGGATTGGAAACCATGAGTTTTGCAAAGATGATTTTGACGTTGAAACCGTTTTCTGGTCTGTCTTTGGTGGCAATCGATCTTACTATTGGTCCTTTATAAATGAGGAAAATCCTCAGTGGAGGTCAGGAGGCTTTTCTAATCATGAGAAATCTTGGAATTGGAGACGTCGGAGTGAAAATGAATATAATGGCACATCAACCGAGCCAGAGTCGGATTGTTCACATTCAGATTTAATTTCAGATAGATTAGCCCTTGGACTGGGTGCTTCTGGCCCTCTGAAACTTGAAGATGTGAAAAATGTGTATCGGATATGTGCCTTAAAGTGGCATCCAGATCGCCATCATGGCTCTTTTAAGGTTATAGCAGAGGAAAAGTTGAAGCATTGCAGTGCTGCTTATCGACCGTTGTCTGATAAGCTGGCCTTGGATTAG

Predicted protein sequences of Glyma09g17020

Limit To All Plant Sequences

>Glyma09g17020.2   sequence type=predicted peptide   gene model=Glyma09g17020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNKSIFTKLFHSTSLLERKPRAFGESVSSLNNSFWKEDDDEDGPSPSQGPSWFRKQYSPKGSGRHIVEKKIMVIYGLFWIGNHEFCKDDFDVETVFWSVFGGNRSYYWSFINEENPQWRSGGFSNHEKSWNWRRRSENEYNGTSTEPESDCSHSDLISDRLALGLGASGPLKLEDVKNVYRICALKWHPDRHHGSFKVIAEEKLKHCSAAYRPLSDKLALD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain