SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g16901

Feature Type:gene_model
Chromosome:Gm09
Start:20565297
stop:20566356
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g16901
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G70980AT Annotation by Michelle Graham. TAIR10: Class II aminoacyl-tRNA and biotin synthetases superfamily protein | chr1:26762339-26764394 FORWARD LENGTH=571 SoyBaseE_val: 1.00E-72ISS
GO:0006418GO-bp Annotation by Michelle Graham. GO Biological Process: tRNA aminoacylation for protein translation SoyBaseN/AISS
GO:0006421GO-bp Annotation by Michelle Graham. GO Biological Process: asparaginyl-tRNA aminoacylation SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0004812GO-mf Annotation by Michelle Graham. GO Molecular Function: aminoacyl-tRNA ligase activity SoyBaseN/AISS
GO:0004816GO-mf Annotation by Michelle Graham. GO Molecular Function: asparagine-tRNA ligase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
PTHR22594Panther ASPARTYL/LYSYL-TRNA SYNTHETASE JGI ISS
PTHR22594:SF6Panther ASPARTYL-TRNA SYNTHETASE JGI ISS
PF00152PFAM tRNA synthetases class II (D, K and N) JGI ISS
UniRef100_G7LJN2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Asparaginyl-tRNA synthetase n=1 Tax=Medicago truncatula RepID=G7LJN2_MEDTR SoyBaseE_val: 5.00E-95ISS
UniRef100_I1K622UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K622_SOYBN SoyBaseE_val: 4.00E-126ISS

Expression Patterns of Glyma09g16901
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g16901 not represented in the dataset
Glyma09g16901 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g16901 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g110400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g16901
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g16901
>Glyma09g16901.1   sequence type=CDS   gene model=Glyma09g16901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGACGCATCTTCTCCACTGATGGATCAACTCGCCGCCATCACCCTCGACGAGGTTCCCAAAGATAATTTCTCCGACCACATCCCCATCCAATCCATCATCTCCCACATCAATGGCGGCTCGGGCCTTGCCAGTAGGAAGGCGCGCGTTGGCAGCTGGGTGAAGACGGGATGCAAAGCCAACAAGGACACTTTCGCGCTCCTGGAAATCAACGACAGAAGTTGCACCGGCAACCTCCAAGTCATCGTCGAAGTCGGGCTGGGTGAACTCGGCCAACTCGTTCCCACCAGAACATGCGTCGTCGTCCTCCACGTTGGTTCCATCGATCCTGCCAAGTATCCTCTGCCCAAAATGAGACTCACTCTCGAGTTCCTCAGAGATTTCATTCACCTTCATTCCAAAACCAACACGATATTTGCGGTGGCTAGAATTAGAAATTCTCTTACGTGTGCTACACATACATTTTTCAACAAGGAAGGGTTTCTATACGTGCACACGCCCATTGTTAGCACAAGTGATTGTGAGGGTGTGGGCGAGATGTTTCAGGTGACCACTTTGCTGAGTGAGGAGAAAGGGAAGGTTATGTCTCAGTTGAAAGCTGCCAAGGCGAGTAAGAAGGAGATTGGTGCTGCTGTGGATCAACTTAAGAAGGCGAATGAGAGTTTGGCTAAGGTGGATCAGCTTAAGCCTGAGATTCTTAAAAAGGATGATGGAAAGGACTATTTTGCAACACCGCCAACAATA
Predicted protein sequences of Glyma09g16901
>Glyma09g16901.1   sequence type=predicted peptide   gene model=Glyma09g16901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADASSPLMDQLAAITLDEVPKDNFSDHIPIQSIISHINGGSGLASRKARVGSWVKTGCKANKDTFALLEINDRSCTGNLQVIVEVGLGELGQLVPTRTCVVVLHVGSIDPAKYPLPKMRLTLEFLRDFIHLHSKTNTIFAVARIRNSLTCATHTFFNKEGFLYVHTPIVSTSDCEGVGEMFQVTTLLSEEKGKVMSQLKAAKASKKEIGAAVDQLKKANESLAKVDQLKPEILKKDDGKDYFATPPTI






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo