Glyma09g16503 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g16503): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g16503): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g16503

Feature Type:	gene_model
Chromosome:	Gm09
Start:	19751399
stop:	19751896
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g16503

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G07320	AT	Annotation by Michelle Graham. TAIR10: ribosomal protein L4 \| chr1:2249190-2250189 FORWARD LENGTH=280	SoyBase	E_val: 2.00E-42	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0019288	GO-bp	Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway	SoyBase	N/A	ISS
GO:0019344	GO-bp	Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process	SoyBase	N/A	ISS
GO:0000311	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid large ribosomal subunit	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009535	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane	SoyBase	N/A	ISS
GO:0009547	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid ribosome	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0009579	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: thylakoid	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0022626	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
GO:0008266	GO-mf	Annotation by Michelle Graham. GO Molecular Function: poly(U) RNA binding	SoyBase	N/A	ISS
PTHR10746	Panther	50S RIBOSOMAL PROTEIN L4	JGI		ISS
PF00573	PFAM	Ribosomal protein L4/L1 family	JGI		ISS
UniRef100_I1JMQ2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JMQ2_SOYBN	SoyBase	E_val: 2.00E-56	ISS
UniRef100_I6YHX2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 50S ribosomal protein n=1 Tax=Linum usitatissimum RepID=I6YHX2_LINUS	SoyBase	E_val: 7.00E-50	ISS

Expression Patterns of Glyma09g16503

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g16503 not represented in the dataset	Glyma09g16503 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g16503 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g108400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g16503

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g16503

Limit To All Plant Sequences

>Glyma09g16503.1   sequence type=CDS   gene model=Glyma09g16503   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCACTTTCCCTCTCTCTCTCCACACCAACGACAGCAACCTCTCTTTCCTTCACATCATCCTGCATCTTCTTCTCTTCACATCAATTCCACACACACAATAATTCTCCCCGGCATAACAAGAAAATGTCCTCAAACAAGTGCCGCGGCACCGACCTCCAGAACAAGCACCGCGGCACCGCCTCCACCCTCACCCGCAGCGAGGTCCGAGGCGGCGGCCGGAAGCCCTTCCCGCAAAAAAAAACCGGCCGCGCCTACCGCGGCTCCAACCGCACTCCCCTCCGCCCCGGCGGAGGCGTCACCTTCGGCCCGAAGCCCTGCGACTGGTCCATCAAGATCAACCGCAAGGAGAAGCGCCTCGCCATCTCCACCGCTGTTGCCAGCGCTGCCGCCAGTGCCGTCGTGGTGGAGGACTTTGTGGCGGAGTTCGCCGAGAAGCCAAAGACGAAGGAGTTCATCGCGGCGATGAAACTGTTACAAGAGAGAGAATACTGA

Predicted protein sequences of Glyma09g16503

Limit To All Plant Sequences

>Glyma09g16503.1   sequence type=predicted peptide   gene model=Glyma09g16503   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLSLSLSTPTTATSLSFTSSCIFFSSHQFHTHNNSPRHNKKMSSNKCRGTDLQNKHRGTASTLTRSEVRGGGRKPFPQKKTGRAYRGSNRTPLRPGGGVTFGPKPCDWSIKINRKEKRLAISTAVASAAASAVVVEDFVAEFAEKPKTKEFIAAMKLLQEREY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain