SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g16080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g16080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g16080

Feature Type:gene_model
Chromosome:Gm09
Start:19157362
stop:19159237
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G41940AT Annotation by Michelle Graham. TAIR10: zinc finger protein 8 | chr2:17507556-17508329 FORWARD LENGTH=257 SoyBaseE_val: 5.00E-37ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010026GO-bp Annotation by Michelle Graham. GO Biological Process: trichome differentiation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR11389Panther ZINC FINGER PROTEIN JGI ISS
PTHR11389:SF374Panther KRAB-RELATED JGI ISS
UniRef100_B9SYV7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nucleic acid binding protein, putative n=1 Tax=Ricinus communis RepID=B9SYV7_RICCO SoyBaseE_val: 1.00E-79ISS
UniRef100_I1L2J7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L2J7_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g16080 not represented in the dataset

Glyma09g16080 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g107400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g16080.1   sequence type=CDS   gene model=Glyma09g16080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACAAGACATCATCAACAACAACAACCTCCGAGAGAGAAACTCACGACTTCATGAACGTCGACTCGTTCTCCCAACTCCCCTTCATCCGCCCGGCTCCTCTTGTCAGAGAGAAGTCAGGCATTCGCCTCTTTGGCATCGAATTTGCCGGCGGAAACAACAACAGCAGCAATAACAATAACAATTTTGTTGTTGTCTCGGCCGAGGATTCTGAGTCGGCCGAAATAACAACAGCAGCCAACACCAACACCAACATCAATAACAACAAACTCAACTCATTCGACCTCGATCCTTCCAACAAGGAGGAAAACACCCCCACTGCCACCAGTACTGGCACCACCGACACGAATGGCGAGAGCAGCCGCCGCTTCGAGTGCCACTACTGCTGCCGCAACTTCCCCACCTCCCAAGCCCTCGGCGGCCACCAAAACGCGCACAAACGCGAACGCCAGCACGCCAAACGTGCGCACCTCCAGTCCACCATGGTTCATGGCAGCACCTTCTCCGACGCGCACCATGTCTACAATCTCATGAACTACCGCTACGGTTCTTCCATTCCAACACCACCACCACCAACAATGCCTTATCCAACATGGAACAACAACAACAACAACACGCGCTTCTACGGAACAACAACAACGACGTCGTTTTCTCACCACCACCAACACCAACAACAACCTATTAACGGAAGCCCCTTAGCATTTTGGCGAATTCCTAATGGCACCACCATTAATAATAATAACCCTAGTTTCAGCCACGAGCGTTCTTCGACGTTGCCGCCTTTGTTCGCGACTGAGGAAATAGCGAACGTGAGAGCCTCCTCGCAGGTTGTTGTCGGAGCCTCGGGGCCGATGACGACGCAAAACCGCTACGTGTATGACTCGAAACAACGCGACCATGTGAGTTTGGATCTTCATCTGTAA

>Glyma09g16080.1   sequence type=predicted peptide   gene model=Glyma09g16080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDKTSSTTTTSERETHDFMNVDSFSQLPFIRPAPLVREKSGIRLFGIEFAGGNNNSSNNNNNFVVVSAEDSESAEITTAANTNTNINNNKLNSFDLDPSNKEENTPTATSTGTTDTNGESSRRFECHYCCRNFPTSQALGGHQNAHKRERQHAKRAHLQSTMVHGSTFSDAHHVYNLMNYRYGSSIPTPPPPTMPYPTWNNNNNNTRFYGTTTTTSFSHHHQHQQQPINGSPLAFWRIPNGTTINNNNPSFSHERSSTLPPLFATEEIANVRASSQVVVGASGPMTTQNRYVYDSKQRDHVSLDLHL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo