SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g15890): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g15890): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g15890

Feature Type:gene_model
Chromosome:Gm09
Start:18879059
stop:18881080
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G15050AT Annotation by Michelle Graham. TAIR10: Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein | chr5:4871820-4873454 REVERSE LENGTH=434 SoyBaseE_val: 9.00E-124ISS
GO:0007020GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule nucleation SoyBaseN/AISS
GO:0016051GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate biosynthetic process SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0008375GO-mf Annotation by Michelle Graham. GO Molecular Function: acetylglucosaminyltransferase activity SoyBaseN/AISS
GO:0016757GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups SoyBaseN/AISS
PTHR19297Panther GLYCOSYLTRANSFERASE 14 FAMILY MEMBER JGI ISS
PTHR19297:SF2Panther GALACTOSYLTRANSFERASE-RELATED JGI ISS
PF02485PFAM Core-2/I-Branching enzyme JGI ISS
UniRef100_B9RUK1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Acetylglucosaminyltransferase, putative n=1 Tax=Ricinus communis RepID=B9RUK1_RICCO SoyBaseE_val: 1.00E-125ISS
UniRef100_I1L2I6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L2I6_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g15890 not represented in the dataset

Glyma09g15890 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g104700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g15890.1   sequence type=CDS   gene model=Glyma09g15890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACATTGCTTTTGGGGCTCACGAAGATCTGCTCCCTCTTCCTCCTCTTCCTCGCCACCCTCACCTCCCCGGAGGGAACCCCCATCCTCCCCTTCTACCGCTCCATCACCGCCGCCTCCTACTCCGTCTTCGTCGAATCCAAGCTCCGCCCCCTCCCCGTCGTCTCCTCCCTCCCCCCTCCGCCGAGCCTCGCCTACCTCGTCTCCGGCTCAAAGGGTGACGACGCCGCCGTCACCCGCGTCCTCTTGGCCCTCTACCACCCCAATAACCGCTACGTGGTCCACCTGGACCTCGAATCCTCGCCGGAGGAACGCTCCGATCTGGTGAGGTTCGTGGAGGGCCACGCGCTGTTCAAGCGGTTCGGGAATGTGAGGGTTATAAAGAAGGCGAATCTCGTCACGTACAGGGGACCCACCATGGTCGCAAACACGCTTCACGCCGTCGCGATTCTGTTGAGGGAGCTTGGGGATTGGGACTGGTTCATCAATCTTAGCGCCTCCGATTACCCACTTGTCACACAAGATGATCTGCTGCATACGTTTTCGTACCTGCCGCGGGATCTGAATTTCATTGATCATACGAGTGACATTGGATGGAAAGATCATCAGCGTGCGAGGCCGATCATCGTTGATCCGGGTTTGTATATGAATAAGAAGCAAGATGTGTTTTGGATTACGCAGAGGAGGAGTAGGCCAACGGCTTTCAAGCTTTTCACAGGTTCGGCTTGGATGACACTGTCAAAATCTTTCATTGATTACTGCATATGGGGATGGGACAACCTACCTCGAACCGTACTCATGTACTATCCAAAG

>Glyma09g15890.1   sequence type=predicted peptide   gene model=Glyma09g15890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTLLLGLTKICSLFLLFLATLTSPEGTPILPFYRSITAASYSVFVESKLRPLPVVSSLPPPPSLAYLVSGSKGDDAAVTRVLLALYHPNNRYVVHLDLESSPEERSDLVRFVEGHALFKRFGNVRVIKKANLVTYRGPTMVANTLHAVAILLRELGDWDWFINLSASDYPLVTQDDLLHTFSYLPRDLNFIDHTSDIGWKDHQRARPIIVDPGLYMNKKQDVFWITQRRSRPTAFKLFTGSAWMTLSKSFIDYCIWGWDNLPRTVLMYYPK







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo