Glyma09g15875 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g15875

Feature Type:	gene_model
Chromosome:	Gm09
Start:	18875270
stop:	18877994
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g15875

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G11980	AT	Annotation by Michelle Graham. TAIR10: Jojoba acyl CoA reductase-related male sterility protein \| chr3:3814484-3816927 FORWARD LENGTH=616	SoyBase	E_val: 2.00E-128	ISS
GO:0009556	GO-bp	Annotation by Michelle Graham. GO Biological Process: microsporogenesis	SoyBase	N/A	ISS
GO:0010584	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen exine formation	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0016620	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	SoyBase	N/A	ISS
GO:0016628	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor	SoyBase	N/A	ISS
GO:0080019	GO-mf	Annotation by Michelle Graham. GO Molecular Function: fatty-acyl-CoA reductase (alcohol-forming) activity	SoyBase	N/A	ISS
PTHR11011	Panther	MALE STERILITY PROTEIN 2-RELATED	JGI		ISS
PTHR11011:SF1	Panther	MALE STERILITY PROTEIN 2	JGI		ISS
PF07993	PFAM	Male sterility protein	JGI		ISS
UniRef100_B9T8K3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Male sterility protein, putative (Fragment) n=1 Tax=Ricinus communis RepID=B9T8K3_RICCO	SoyBase	E_val: 5.00E-155	ISS
UniRef100_UPI000233C1A8	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233C1A8 related cluster n=1 Tax=unknown RepID=UPI000233C1A8	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g15875

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g15875 not represented in the dataset	Glyma09g15875 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g15875

Paralog	Evidence	Comments
Glyma02g26670	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g15875 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma09g15875

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g15875

Limit To All Plant Sequences

>Glyma09g15875.1   sequence type=CDS   gene model=Glyma09g15875   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGGCTAAACCAAAGATACAGCTCAAGGGAGAACCAAAACTAGCCAAATTTTTAGCCAAGGTTTCAAGTCAATCACATTTAGCTAGCACTACCGTTTTGTCTGAACTTTGTTCCTCATTTTTTTCCCTGCAAAGTCATCATCATTGGGGTCTTGTCCATGGCTTATTCTTATTCCTCAAGAGGAAGGGAAATGTTGTGTATTGCCAAGGGGGTGGGAAGAATGTGATCAAGTCCTCATCCTCAGGAAGCTTGTCTTCTGTGTTGACAGAAAGATCATCATTGGTTGGCACAGATCATGAAGCTGCAGTAACTCTAATGGATGCAGGAAGCTTGGTCTTGTCACAAAATGGGAAAAGCCAGGCAGAGATTGTGGTGAAGGATTTGGTGCCTTATGGTGGAACAACAACATTGATAGGGTTGGAAGATGGAATAGGCATTGTCAAGTTTCTTGGAGGGAAAAAGTTTTTCATTACTGGGGCAACTGGGTTTCTAGCCAAAGTTTTTATTGAGAAGATTCTAAGGACAGAACCAGATGTGGGGAAAATGTACCTTTTGATCAAGGCAAAGAATAACCAAGCTGCAATGGAGAGATTGCAAAATGAAATCATAAACACACAACTTTTCAGATGCCTTCAAGAAATCCATGGAAAATCATACCAAGCCTTTATGTTGAGCAAGCTAGTTCCTGTTGTAGGCAATATTTGTGAACACAATCTTGGACTAGATGAAGATATATCTAATGTTATAGCAGAGGAGGTAGATGTCTTTGTAAATTCTGCAGCTAATACAACATTTGATGAAAGATATGATACTGCTATCAACATAAACACCATAGGGCCATGCCGCCTTATGAACATTGCCAAAAAGTGCAAGAAGCTCAAGCTCTTTCTGCATGTTTCAACAGCATATGTCAATGGACAAAAGCAAGGTAGGATCATGGAGAGACCATTTAGCATTGGAGAGTGCATAGCAAGAGAAAAATATATATCTGAAGTTTCACCAAAATACCTTCCCACATTGGACATTGAAGGAGAAATAAATCTGGTTTCAAATTACAAAGGGGACATTGAAGATAACTTACTAACTCAGAAAATGAAGGAGATTGGTCTAGAGAGGGCAAGAAGATATGGGTGGCAGGATACATATGTGTTCACAAAGGCTATGGGAGAAATGATGATTGACAAATTGAGAGGGGATATTCCAGTTGTTGTAATGCGACCAAGTGTTATTGAGAGCACTTTCAGTGAACCATTTCCTGGGTGGATGGAAGGAAAT

Predicted protein sequences of Glyma09g15875

Limit To All Plant Sequences

>Glyma09g15875.1   sequence type=predicted peptide   gene model=Glyma09g15875   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVAKPKIQLKGEPKLAKFLAKVSSQSHLASTTVLSELCSSFFSLQSHHHWGLVHGLFLFLKRKGNVVYCQGGGKNVIKSSSSGSLSSVLTERSSLVGTDHEAAVTLMDAGSLVLSQNGKSQAEIVVKDLVPYGGTTTLIGLEDGIGIVKFLGGKKFFITGATGFLAKVFIEKILRTEPDVGKMYLLIKAKNNQAAMERLQNEIINTQLFRCLQEIHGKSYQAFMLSKLVPVVGNICEHNLGLDEDISNVIAEEVDVFVNSAANTTFDERYDTAININTIGPCRLMNIAKKCKKLKLFLHVSTAYVNGQKQGRIMERPFSIGECIAREKYISEVSPKYLPTLDIEGEINLVSNYKGDIEDNLLTQKMKEIGLERARRYGWQDTYVFTKAMGEMMIDKLRGDIPVVVMRPSVIESTFSEPFPGWMEGN

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain