|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT2G38870 | AT | Annotation by Michelle Graham. TAIR10: Serine protease inhibitor, potato inhibitor I-type family protein | chr2:16236546-16237050 REVERSE LENGTH=70 | SoyBase | E_val: 2.00E-15 | ISS |
| GO:0009611 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to wounding | SoyBase | N/A | ISS |
| GO:0015824 | GO-bp | Annotation by Michelle Graham. GO Biological Process: proline transport | SoyBase | N/A | ISS |
| GO:0050832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to fungus | SoyBase | N/A | ISS |
| GO:0005576 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: extracellular region | SoyBase | N/A | ISS |
| GO:0005618 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cell wall | SoyBase | N/A | ISS |
| GO:0004867 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: serine-type endopeptidase inhibitor activity | SoyBase | N/A | ISS |
| PF00280 | PFAM | Potato inhibitor I family | JGI | ISS | |
| UniRef100_G7I4R6 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Inhibitor of trypsin and hageman factor n=1 Tax=Medicago truncatula RepID=G7I4R6_MEDTR | SoyBase | E_val: 6.00E-26 | ISS |
| UniRef100_UPI000233D7A8 | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233D7A8 related cluster n=1 Tax=unknown RepID=UPI000233D7A8 | SoyBase | E_val: 1.00E-36 | ISS |
|
Glyma09g15770 not represented in the dataset |
Glyma09g15770 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.09g103800 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma09g15770.1 sequence type=CDS gene model=Glyma09g15770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTCCGTGATCAATGGTAAGTTCTCATGGCCTGAGTTGGTTGGGGTGCAAGGAACGGTAGCGGAGGCTACAATTGAGAGGGAGAATCCTTCGGTGAATGCTATTATTGTGCCTCTAGGATCCGTGGTCACAACGGATCTTCGAAGTGACAGGGTTTGGGTTTGGGTTAATAAAGATGGAATTGTTAATAGAGTTCCAAAAATTGGATAG
>Glyma09g15770.1 sequence type=predicted peptide gene model=Glyma09g15770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MSVINGKFSWPELVGVQGTVAEATIERENPSVNAIIVPLGSVVTTDLRSDRVWVWVNKDGIVNRVPKIG*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||