Glyma09g14870 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g14870): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g14870): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g14870

Feature Type:	gene_model
Chromosome:	Gm09
Start:	16928138
stop:	16930454
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g14870

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G58070	AT	Annotation by Michelle Graham. TAIR10: temperature-induced lipocalin \| chr5:23500512-23501156 REVERSE LENGTH=186	SoyBase	E_val: 9.00E-98	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009416	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to light stimulus	SoyBase	N/A	ISS
GO:0042538	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
KOG4824	KOG	Apolipoprotein D/Lipocalin	JGI		ISS
PTHR10612	Panther	LIPOCALIN/APOLIPOPROTEIN D	JGI		ISS
PTHR10612:SF7	Panther	OUTER MEMBRANE LIPOPROTEIN BLC	JGI		ISS
PF08212	PFAM	Lipocalin-like domain	JGI		ISS
UniRef100_Q38JD2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Temperature-induced lipocalin n=1 Tax=Glycine max RepID=Q38JD2_SOYBN	SoyBase	E_val: 5.00E-132	ISS
UniRef100_Q38JD2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Temperature-induced lipocalin n=1 Tax=Glycine max RepID=Q38JD2_SOYBN	SoyBase	E_val: 5.00E-132	ISS

Expression Patterns of Glyma09g14870

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g14870 not represented in the dataset	Glyma09g14870 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g14870 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g098900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g14870

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g14870

Limit To All Plant Sequences

>Glyma09g14870.1   sequence type=CDS   gene model=Glyma09g14870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAACAAAGAGATGGAAGTTGTGAAGGGTTTGGATTTGCAAAGGTACATGGGGCGTTGGTATGAGATAGCCTCTTTCCCTTCAAGGAATCAGCCCAAGGATGGTGAGAACACCAGAGCCACATACACTCTTAGGAATGATGGTACTGTGCAAGTGCTCAACGAGACTTGGAGTAATGGCAAGAGAGGGTACATACAAGGAACTGCTTATAAGGTTGACCCCAAAAGTGATGAGGCCAAGTTCAAGGTCAAGTTTTATATTCCTCCCTTCTTGCCCATTATACCTATAAATGGGGACTACTGGGTTTTGTTCACTGACGATGAATATCAGTATGCTTTGATTGGCCAACCAAGCAGGAATTACCTTTGGATATTAAGCAGGAAACCCCATCTGGATGATGAGATCTACAACGAGCTTGTTCAGAGAGCTAAGAATGTAGGATATGATGTGAGCAAACTCCGCAAGACCCCACAGAGCGATCCTCCACCAGAGGAAGAAGGCCCTGATGACACCAAAGGCATTTGGTGGCTCAAATCCATTTTTGGAAAATAG

Predicted protein sequences of Glyma09g14870

Limit To All Plant Sequences

>Glyma09g14870.1   sequence type=predicted peptide   gene model=Glyma09g14870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANKEMEVVKGLDLQRYMGRWYEIASFPSRNQPKDGENTRATYTLRNDGTVQVLNETWSNGKRGYIQGTAYKVDPKSDEAKFKVKFYIPPFLPIIPINGDYWVLFTDDEYQYALIGQPSRNYLWILSRKPHLDDEIYNELVQRAKNVGYDVSKLRKTPQSDPPPEEEGPDDTKGIWWLKSIFGK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain