SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g10020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g10020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g10020

Feature Type:gene_model
Chromosome:Gm09
Start:10042510
stop:10056645
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G44560AT Annotation by Michelle Graham. TAIR10: SNF7 family protein | chr5:17946081-17948222 FORWARD LENGTH=222 SoyBaseE_val: 2.00E-128ISS
GO:0000226GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0015031GO-bp Annotation by Michelle Graham. GO Biological Process: protein transport SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0016572GO-bp Annotation by Michelle Graham. GO Biological Process: histone phosphorylation SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0000815GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ESCRT III complex SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG3230 KOG Vacuolar assembly/sorting protein DID4 JGI ISS
PTHR10476Panther SNF7-RELATED JGI ISS
PTHR10476:SF4Panther BC-2 - RELATED JGI ISS
PF03357PFAM Snf7 JGI ISS
UniRef100_I1L219UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L219_SOYBN SoyBaseE_val: 8.00E-154ISS
UniRef100_Q0WTY4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar protein sorting-associated protein 2 homolog 2 n=2 Tax=Arabidopsis thaliana RepID=VPS2B_ARATH SoyBaseE_val: 8.00E-126ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g10020 not represented in the dataset

Glyma09g10020 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma15g22150 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g083700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g10020.1   sequence type=CDS   gene model=Glyma09g10020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACATGAATATCTTCAAGAAGAAAACCTCACCCAAAGAGGCTCTGCGGTCAAGTAAGAGGGAAATGGCTGTTGCAACCAGAGGAATTGAAAGAGAGATAGCATCACTTCAGATGGAGGAAAAAAAATTGGTGGCAGAGATTAAAAGAGAAGCAAAAACAGGAAATGAGGCTGCCACCAGAATCTTAGCTCGTCAACTTGTTAGGTTACGTCAACAGATAACCAATTTGCAGGGAAGTCGTGCTCAGATCAGGGGTGTAGCAACTCACACACAGGCATTATATGCAAGCACTTCAATCTCTACAGGAATGAAGGGTGCAACTAAAGCAATGGTGGCAATGAATAAGCAAATGGCACCGGCAAAACAGGTTAAAGTGATCAAAGAATTCCAAAAGCAATCAGCGCAGTTGGACATGACGATTGAGATGATGTCAGAATCTATTGATGAAACTCTAGACAAAGATGAAGCTGAGGAAGAAACAGAAGAGCTCACTAACCAGGTTCTTGATGAGATTGGAGTGGATATTGCATCCCAGTTATCTTCTGCTCCCAAAGGGCGTATTGCTTCAAGGAATACTGAAAATGTTGCTCCAAGACCAGCAGAATCCCAAGATGTCGAAGAACTTGAAAAGAGATTGGCTTCTCTTCGAAGAATTTAA

>Glyma09g10020.1   sequence type=predicted peptide   gene model=Glyma09g10020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNMNIFKKKTSPKEALRSSKREMAVATRGIEREIASLQMEEKKLVAEIKREAKTGNEAATRILARQLVRLRQQITNLQGSRAQIRGVATHTQALYASTSISTGMKGATKAMVAMNKQMAPAKQVKVIKEFQKQSAQLDMTIEMMSESIDETLDKDEAEEETEELTNQVLDEIGVDIASQLSSAPKGRIASRNTENVAPRPAESQDVEELEKRLASLRRI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo