Glyma09g08440 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g08440

Feature Type:	gene_model
Chromosome:	Gm09
Start:	7685885
stop:	7687037
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g08440

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G43110	AT	Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20790.1); Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). \| chr3:15091710-15	SoyBase	E_val: 1.00E-30	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009744	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus	SoyBase	N/A	ISS
GO:0009813	GO-bp	Annotation by Michelle Graham. GO Biological Process: flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0010224	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to UV-B	SoyBase	N/A	ISS
GO:0016036	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation	SoyBase	N/A	ISS
GO:0019375	GO-bp	Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_I1L1T8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1L1T8_SOYBN	SoyBase	E_val: 3.00E-149	ISS

Expression Patterns of Glyma09g08440

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g08440

Paralog	Evidence	Comments
Glyma15g20080	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g08440 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma09g08440

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g08440

Limit To All Plant Sequences

>Glyma09g08440.1   sequence type=CDS   gene model=Glyma09g08440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATGTCTTGGATTCTAATGTGGAAGCTCTAGCCTTCAACTACTTGAGCTTCGGTTTTCTCACTGCCCTCAACAACCTATGGACCTGGCTCGCTCTCTTAACCGCCGCCCTCAGCTTCTGGAAGATTCGCTCCGCGGGCTGCCCCAAGCCCAGGCCCAAGACCGAGGCCCAAGCCCAACCTTTTTTCAGGCCTGAGGCTGTCGCGGATTTGTTAATAGTGGAGAAAACGGAGCCGACGAAACAACATGCAGCGACGGCTCCGTTTTCTCCACCGTTATTACGAGGAGAAAATAACAGTGAAGAAAACGGCGAGAGGAAGGGGAAGTTTACCGTTTATTACGAGGAGGAGGACATGGGCATGCAATGCACGTGCGATGAGAATGAGGGGTTGTTAACGGCGTGGAAAGAGAAAGAGGGGACCGAAACGGAGTGGTGGAATAGGTGGGAGAGGTTGTTGCAGTTGAGAAATGGGGAGAGCGAGAACGGGTGGTACAGGTGGCAGGACTTGACGGAGCTTAACGGCAGCGTCGTTAGGATATGGGACGGTGGGTTAAGTGGTTCTTCCGTTAGGGAATCGTGGTACAACAACTACAACTCTAGCTGTATGCATGTCTGGTAA

Predicted protein sequences of Glyma09g08440

Limit To All Plant Sequences

>Glyma09g08440.1   sequence type=predicted peptide   gene model=Glyma09g08440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNVLDSNVEALAFNYLSFGFLTALNNLWTWLALLTAALSFWKIRSAGCPKPRPKTEAQAQPFFRPEAVADLLIVEKTEPTKQHAATAPFSPPLLRGENNSEENGERKGKFTVYYEEEDMGMQCTCDENEGLLTAWKEKEGTETEWWNRWERLLQLRNGESENGWYRWQDLTELNGSVVRIWDGGLSGSSVRESWYNNYNSSCMHVW*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain