SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g08370

Feature Type:gene_model
Chromosome:Gm09
Start:7553056
stop:7559963
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g08370
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G40700AT Annotation by Michelle Graham. TAIR10: P-loop containing nucleoside triphosphate hydrolases superfamily protein | chr2:16976783-16979392 FORWARD LENGTH=609 SoyBaseE_val: 0ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006406GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus SoyBaseN/AISS
GO:0006606GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus SoyBaseN/AISS
GO:0006626GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009561GO-bp Annotation by Michelle Graham. GO Biological Process: megagametogenesis SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0042991GO-bp Annotation by Michelle Graham. GO Biological Process: transcription factor import into nucleus SoyBaseN/AISS
GO:0051604GO-bp Annotation by Michelle Graham. GO Biological Process: protein maturation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0004386GO-mf Annotation by Michelle Graham. GO Molecular Function: helicase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008026GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP-dependent helicase activity SoyBaseN/AISS
KOG0348 KOG ATP-dependent RNA helicase JGI ISS
PTHR24031Panther FAMILY NOT NAMED JGI ISS
PTHR24031:SF25Panther SUBFAMILY NOT NAMED JGI ISS
PF00270PFAM DEAD/DEAH box helicase JGI ISS
PF00271PFAM Helicase conserved C-terminal domain JGI ISS
UniRef100_G7JPD2UniRef Annotation by Michelle Graham. Most informative UniRef hit: DEAD-box ATP-dependent RNA helicase n=1 Tax=Medicago truncatula RepID=G7JPD2_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI0002337D02UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337D02 related cluster n=1 Tax=unknown RepID=UPI0002337D02 SoyBaseE_val: 0ISS

Expression Patterns of Glyma09g08370
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g08370
ParalogEvidenceComments
Glyma15g20000 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g08370 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g072400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g08370
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g08370
>Glyma09g08370.1   sequence type=CDS   gene model=Glyma09g08370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGGCGAAGAAGCAGAGCCAGGGAGTGAAAAATAAGGGTAATGGCGCCAACAATGATGTTTTCGCGTCATGCTCCTTCTCCAGCCTTGGACTTGATTCCAATTTATGTGAACAACTTCGTGATAGGTTGGGGTTTGAAGTTCCAACGCTGGTGCAAGCTCAAGCAATTCCCGTTATTCTCTCGGGGCGGCATGCATTGGTGAATGCTGCAACGGGCACGGGGAAGACTGTTGCGTATTTGGCTCCGATTATTCATCACTTGCAGGGTTATGAAAATCGGATTCAGCGCTCTGATGGAACATTTGCGTTGGTTCTTGTACCGACGCGGGAGCTATGCTTGCAGGTTTATGAAATTCTTCAAAAGTTATTGCATCGGTTTCATTGGATTGTTCCAGGATACATCATGGGTGGTGAAAAGAGATCAAAAGAGAAATCAAGGCTGCGCAAAGGCATATCAATTCTTATAGCAACTCCTGGGCGCCTTTTAGATCACTTGAAGAACACAACAGCATTCTTGTACTCAAATTTACGCTGGATAATTTTTGATGAAGCTGACCGGATTTTGGAATTGGGATTTGGAAAAGATATAGAGGAAATACTAGATCTTTTAGGCTCAAGGAAAAAAGGGCATGGTGATCAAGAGAATACAGTTCTAACACACTCTAAAATTCAAAGACAGAATTTGCTTTTATCTGCCACCTTAAATGAGAAAGTGAACCACCTTGCTAAAATGAGTCTAGACAATCCAGTTATGATTGGTCTTGATGGTAAGAAAATGGAACCAATTTCAACAATTAAAAGGCTTGATTCTTCAGAATCTGATGAAGACAGTGAAGATAAATATTCCAGTAAAGTACCAACAGTTGGAGATTACAAAGTCCCCATACAGTTGATTCAGAGATACATGAAAGTGCCATGTGGTTCACGGCTTCCTGTACTTCTTTCAATTCTAAAGCATCTCTTTGAAAGAGAACCTTCACAAAAGGTCGTTTTATTCTTTTCAACATGTGATGCAGTAGATTTTCACTATTCACTGTTAAGTGAATTTCAATTTTCATCCTATCCACAAACAGAAGGGGTCCGACAGGTGTTTCTTGGATGCAAAACTTTCCGGTTACATGGTAATATGCAACAAGAGGACCGGAGAACCAGTTTTCAGGCCTTTAAAACTGAGAAATCTGCTCTGCTTTTGTCCACTGATGTTTCTGCTAGAGGATTGGATTTTCCAAAGGTTAGGTGCATCATACAATATGATTCTCCTGGGGAAGCTACGGAATATGTTCATAGAGTTGGTAGAACTGCTCGACTGGGTGAAAGAGGAGAGTCATTATTATTTCTGCAACCAGTTGAAATAGACTATTTACAGGACTTGGAGAAACATGGTGTCTCACTCACGGAGTATCCTGTCCTCAAAGTGTTGGATAGTTTTCCACTACAAAAGAACCACACAAAGAAGTCTGTTTTCTTAGAGTCACATCCCTGGGTCCTTTGTCTCCAGAAGGCACTTGAAGCCTTCATCATGTCCAAGCCCGAAATGGATGAACATGCCAGGAAGGCATTTTGCTCTTGGGTTCGTGCGTACACAGCCCATCGCGGTGAGCTGAAAAGAATATTATGA
Predicted protein sequences of Glyma09g08370
>Glyma09g08370.1   sequence type=predicted peptide   gene model=Glyma09g08370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGAKKQSQGVKNKGNGANNDVFASCSFSSLGLDSNLCEQLRDRLGFEVPTLVQAQAIPVILSGRHALVNAATGTGKTVAYLAPIIHHLQGYENRIQRSDGTFALVLVPTRELCLQVYEILQKLLHRFHWIVPGYIMGGEKRSKEKSRLRKGISILIATPGRLLDHLKNTTAFLYSNLRWIIFDEADRILELGFGKDIEEILDLLGSRKKGHGDQENTVLTHSKIQRQNLLLSATLNEKVNHLAKMSLDNPVMIGLDGKKMEPISTIKRLDSSESDEDSEDKYSSKVPTVGDYKVPIQLIQRYMKVPCGSRLPVLLSILKHLFEREPSQKVVLFFSTCDAVDFHYSLLSEFQFSSYPQTEGVRQVFLGCKTFRLHGNMQQEDRRTSFQAFKTEKSALLLSTDVSARGLDFPKVRCIIQYDSPGEATEYVHRVGRTARLGERGESLLFLQPVEIDYLQDLEKHGVSLTEYPVLKVLDSFPLQKNHTKKSVFLESHPWVLCLQKALEAFIMSKPEMDEHARKAFCSWVRAYTAHRGELKRIL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo