Glyma09g08131 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g08131

Feature Type:	gene_model
Chromosome:	Gm09
Start:	7190022
stop:	7193735
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g08131

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G20635	AT	Annotation by Michelle Graham. TAIR10: FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: keratin filament, chloroplast; CONTAINS InterPro DOMAIN/s: Keratin, high sulphur B2 protein (InterPro:IPR002494); Has 6153 Blast hits to 2882 proteins in 265 species: Archae - 6; Bacteria - 47; Metazoa - 4777; Fungi - 68; Plants - 187; Viruses - 30; Other Eukaryotes - 1038 (source: NCBI BLink). \| chr5:6979314-6981767 REVERSE LENGTH=251	SoyBase	E_val: 3.00E-34	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0045095	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: keratin filament	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_Q6AWT8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Guanine nucleotide-binding protein subunit gamma 3 n=1 Tax=Arabidopsis thaliana RepID=GG3_ARATH	SoyBase	E_val: 2.00E-31	ISS
UniRef100_UPI000233D07A	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D07A related cluster n=1 Tax=unknown RepID=UPI000233D07A	SoyBase	E_val: 8.00E-147	ISS

Expression Patterns of Glyma09g08131

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g08131 not represented in the dataset	Glyma09g08131 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g08131

Paralog	Evidence	Comments
Glyma15g19631	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g08131 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g070100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g08131

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g08131

Limit To All Plant Sequences

>Glyma09g08131.1   sequence type=CDS   gene model=Glyma09g08131   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCACTTCCACAAGGGCAACTTCCAACATCCTTCTCTCTCTGCCACTGCCCTCTCCTAAGGCGGCGCCTCCTTCGTGCCCAGATTTGTATGGAAAGCGTCGCGAAATGGCCAAGATTCAGATGCTGGAAAGAGAGATAAGTTTCCTCGAGGAAGAGTTAAAATCTTCTGAAGGCCTTCAACCAGCTTCAAGATGCTGCAAAGAGATTGCCGATTTTGTGATGGCAAACTCAGATCCTCTGTTACCTACGAGCAAGAAGAACCACCGGTCATGTAGCTTCTGGAAGTGGCTGTGTGACATCCCTTGCTTTAACTTGTCTTGGATCTGCCATTGGTGCTGTGATGGGTGCTTTGAACATCAAAACATGTCAAGTTGTTGTTCCCACTGCATGCCATGCAATTGCTGTTCTAGTTGTCTTCCATCTACCAATTGCTCTTGCTGCCCTAATGGAATATCACATTGCTGCAAAGATAGTTGTGGTTGCAAAATTTGTTGCACTCTCCCAAGTTGCAATATTGGGTGGCCTTTTCCCTCTTGCTGCATTTGCAAATGCTCTTGCTCTTGCTCTTGGTCAGGCCCAAAAAAATGTCCCAAGGTTCGTCCATGTTGCTGTTGTACAAATTCCTGTTGGAACCCCTGTTCATGTTTCTAG

Predicted protein sequences of Glyma09g08131

Limit To All Plant Sequences

>Glyma09g08131.1   sequence type=predicted peptide   gene model=Glyma09g08131   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSTSTRATSNILLSLPLPSPKAAPPSCPDLYGKRREMAKIQMLEREISFLEEELKSSEGLQPASRCCKEIADFVMANSDPLLPTSKKNHRSCSFWKWLCDIPCFNLSWICHWCCDGCFEHQNMSSCCSHCMPCNCCSSCLPSTNCSCCPNGISHCCKDSCGCKICCTLPSCNIGWPFPSCCICKCSCSCSWSGPKKCPKVRPCCCCTNSCWNPCSCF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain