SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g06290

Feature Type:gene_model
Chromosome:Gm09
Start:5054661
stop:5055945
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g06290
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G18969AT Annotation by Michelle Graham. TAIR10: BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding transcription factors;transcription regulators (TAIR:AT4G30180.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr2:8229047-8229574 REVERSE LENGTH=175 SoyBaseE_val: 4.00E-28ISS
UniRef100_D7MC79UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor/ transcription regulator n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MC79_ARALL SoyBaseE_val: 1.00E-17ISS
UniRef100_I1L1A6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L1A6_SOYBN SoyBaseE_val: 2.00E-152ISS

Expression Patterns of Glyma09g06290
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g06290
ParalogEvidenceComments
Glyma15g17550 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g06290 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g056600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g06290
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g06290
>Glyma09g06290.1   sequence type=CDS   gene model=Glyma09g06290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGTCAACCAGCTAAAAGGAGACGTGTATACTCACTTGAACCAACTAAAGTGGAACAAGCAGCGTTTGCAAGAAACTACATGAATTGTTTGGTGCCAGCATTGATGAAGATCAAGGAAAGATCAAGCACTTCAGCAGAACAACATAGTGTTCATTCATGTGATGATGACAATATTCAGAATGTTGTCAAGTATGAAGTGGACATGGCAATGGTGCGCTCAGCCCAAGGGTATGCATGGAGCAATGCTTTAAGTGTGAAGCTTCAAAGGAATAGAGTCAATGTAGATTGTGACACCACTAGCTTTGGGGAAGGTTCACCATCAAGGGTTTGTGGCCAAAACTATGAAATGGTGCCATTGAGTAATTTCTCTTCAAACCCTAGTTTGAAGTCTAATAACAAGTGCAAGGAAATGTCTGAAATGAAAAGGGGTTTGAGAGAAGATGATGATGGTGGTGGTGATGAAGATGAAGTCATCAAGGGCCAATTGAAGAGCCTAAGAAGGTTGATACCTGGTGGAGAAGAGATGTGTAGTGAACAAATGGTGACTGAGCTACAAAGCTATGTAAGCTGTTTGCAAATGCAGGTGAACATTCTTCAGTGCCTCGCTGAGACACATTGA
Predicted protein sequences of Glyma09g06290
>Glyma09g06290.1   sequence type=predicted peptide   gene model=Glyma09g06290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGQPAKRRRVYSLEPTKVEQAAFARNYMNCLVPALMKIKERSSTSAEQHSVHSCDDDNIQNVVKYEVDMAMVRSAQGYAWSNALSVKLQRNRVNVDCDTTSFGEGSPSRVCGQNYEMVPLSNFSSNPSLKSNNKCKEMSEMKRGLREDDDGGGDEDEVIKGQLKSLRRLIPGGEEMCSEQMVTELQSYVSCLQMQVNILQCLAETH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo