SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g05311): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g05311): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g05311

Feature Type:gene_model
Chromosome:Gm09
Start:4111530
stop:4116686
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G46550AT Annotation by Michelle Graham. TAIR10: Fasciclin-like arabinogalactan family protein | chr3:17136612-17137874 REVERSE LENGTH=420 SoyBaseE_val: 4.00E-72ISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009897GO-cc Annotation by Michelle Graham. GO Cellular Compartment: external side of plasma membrane SoyBaseN/AISS
GO:0031225GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane SoyBaseN/AISS
GO:0046658GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane SoyBaseN/AISS
GO:0030247GO-mf Annotation by Michelle Graham. GO Molecular Function: polysaccharide binding SoyBaseN/AISS
PTHR10900Panther TRANSFORMING GROWTH FACTOR JGI ISS
PTHR10900:SF23Panther FLA (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN) JGI ISS
PF02469PFAM Fasciclin domain JGI ISS
UniRef100_A9XTL4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fasciclin-like arabinogalactan protein 9 n=1 Tax=Gossypium hirsutum RepID=A9XTL4_GOSHI SoyBaseE_val: 3.00E-100ISS
UniRef100_UPI000233CA7EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233CA7E related cluster n=1 Tax=unknown RepID=UPI000233CA7E SoyBaseE_val: 6.00E-161ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g05311 not represented in the dataset

Glyma09g05311 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma15g16650 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g05311.1   sequence type=CDS   gene model=Glyma09g05311   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACGGAATGGCTTCTTTGGCCGCCGGGTCATGGCTACCACAACTTCAACGTTGCCGCCTCCATGCTCGCTGCTTCCGGCGTCGAACAGGAATTTGAAGCGGACGAGGGTGGTGCCGGAATCACGCTCTTTGTCCCCGTCGACGACGCATTCGCGGATCTCCCTCCCTCTGTTGCTCTTCAGTCTCTTCCCGCGGATAAGAAAGCCGTTGTTCTCAAATTCCACGTGCTCCATTCGTATTACCCTCTTGGTTCTCTTGAATCAGTTGTTAACCCCTTTCAACCTACCCTTGCTACTGAGGCCATGGGTGCTGGCAGCTTCACGCTCAACATTTCCCGCGTGAACGGCTCTGTCGCCATCAACACCGGCATCGTTCAGGCCTCAATTACGCAGACCGTGTTTGATCAGAACCCTGTTGCCATTTTCGGGGTTTCCAAGGTTCTCTTGCCTAGGGAAATTTTTGGGAAAAATCCGACTGTGTCCACCAAGCCTCTTGATAATGCTCCTCCACCGGATGATGATGCTTTGTCACCGGAGAATTCACCGGGATTTGATGGACAGCCCTCACACCTATCTTCGCCACCGGGATTTCGTGAAGATGTGAGGTCTCATGCTGGTGGTGCTGGTGGTTCCTTGAACTTTGTTGTTCTTCTTTGCTGTATAGGATTGTATTTTGTGGTATAG

>Glyma09g05311.1   sequence type=predicted peptide   gene model=Glyma09g05311   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTEWLLWPPGHGYHNFNVAASMLAASGVEQEFEADEGGAGITLFVPVDDAFADLPPSVALQSLPADKKAVVLKFHVLHSYYPLGSLESVVNPFQPTLATEAMGAGSFTLNISRVNGSVAINTGIVQASITQTVFDQNPVAIFGVSKVLLPREIFGKNPTVSTKPLDNAPPPDDDALSPENSPGFDGQPSHLSSPPGFREDVRSHAGGAGGSLNFVVLLCCIGLYFVV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo