SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g04910

Feature Type:gene_model
Chromosome:Gm09
Start:3682706
stop:3688997
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g04910
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G15900AT Annotation by Michelle Graham. TAIR10: pleiotropic regulatory locus 1 | chr4:9023775-9027443 FORWARD LENGTH=486 SoyBaseE_val: 0ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009749GO-bp Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus SoyBaseN/AISS
GO:0009755GO-bp Annotation by Michelle Graham. GO Biological Process: hormone-mediated signaling pathway SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009870GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-dependent SoyBaseN/AISS
GO:0009880GO-bp Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010072GO-bp Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010204GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-independent SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0080008GO-cc Annotation by Michelle Graham. GO Cellular Compartment: CUL4-RING ubiquitin ligase complex SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0285 KOG Pleiotropic regulator 1 JGI ISS
PTHR19923Panther WD40 REPEAT PROTEINPRL1/PRL2-RELATED JGI ISS
PF00400PFAM WD domain, G-beta repeat JGI ISS
UniRef100_E4MVI9UniRef Annotation by Michelle Graham. Most informative UniRef hit: mRNA, clone: RTFL01-04-F10 n=1 Tax=Eutrema halophilum RepID=E4MVI9_THEHA SoyBaseE_val: 0ISS
UniRef100_UPI00003DB084UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00003DB084 related cluster n=1 Tax=unknown RepID=UPI00003DB084 SoyBaseE_val: 0ISS

Expression Patterns of Glyma09g04910
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g04910
ParalogEvidenceComments
Glyma15g15960 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g04910 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g043800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g04910
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g04910
>Glyma09g04910.1   sequence type=CDS   gene model=Glyma09g04910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGTGGAGCCCGTGGAGCCGCAGTCGCTGAAGAAGCTAAGCTTCAAGTCTCTGAAGCGCGCTCTCGATCTCTTCTCTCCCATCCACGGACACCTCGCTACTCCCGATGCCGAAAGCAAGAAAATACGCACTAGCCACAAGGTGAGCGTGGAGTATGGTGGAATCAAAAGCACTGCCAATCAACCTCCTCCTCGTCAAGTTAGTTCTGCCACCCAGGATCCAGGGTCCTCTAACACTCTGGCTCTTCCAGGTCCCGGAGATTCCAAGGATTCTCAGAAAGGAGGACCCCAAAATGCCTTGGTTGTTGGTCCAACTATCCCATCCACAACACCGAATGATACTGGTTTTCAGAACAAAAGTACAGCGGTTGTTTCAGCCTCTGGTTCATCTGAAAGAAATTTATCAACATCTGCTTTGATGGAAAGAATGCCAAGTAAATGGCCACGTCCTGTATGGCACGCACCATGGAAGAACTACAGGGTCATCAGCGGTCACTTGGGATGGGTGAGATCTGTTGCAGTTGATCCCAGTAACACATGGTTTTGTACTGGTTCTGCAGATCGAACTATCAAGATATGGGACTTGGCAAGTGGAGTATTGAAGCTCACATTAACAGGCCACATTGAACAAGTTAGAGGTCTTGCTGTTAGCAACAGACATACTTACATGTTCTCTGCTGGTGACGATAAACAAGTTAAATGTTGGGATCTTGAACAGAATAAGGTTATTAGGTCTTATCATGGTCATCTGAGTGGTGTTTATTGCTTGGCTCTTCATCCCACAATTGACGTTTTACTAACCGGAGGACGTGATTCTGTCTGCCGGGTTTGGGATATACGAAGTAAAATGCAGATTCATGCTCTTTCAGGTCATGATAACACTGTCTGTTCTGTGTTTACGCGGCCAACGGATCCCCAAGTTGTTACAGGTTCTCATGACACTACCATCAAGATGTGGGACCTTAGATATGGTAAAACAATGTCAACTCTTACAAACCATAAAAAATCTGTTCGAGCAATGGCCCAGCATCCCAAAGAGCAAGCTTTTGCATCTGCTTCAGCTGACAATATTAAAAAGTTCACCCTTCCAAAAGGAGAATTTTGCCACAATATGCTCTCTCAACAGAAAACTATCATCAATGCAATGGCTGTCAATGAGGAGGGTGTGATGGTTACTGGAGGCGACAATGGCAGCATGTGGTTCTGGGATTGGAAGAGTGGTCACAATTTCCAGCAATCCCAAACAATTGTCCAGCCTGGTTCATTGGACAGTGAAGCTGGTATTTATGCTTGTACCTATGATCTTACTGGTTCGAGGCTCATAACCTGCGAAGCTGACAAGACGATAAAAATGTGGAAAGAAGATGAGAGTGCCACTCCAGAAACCCATCCCCTTAACTTCAGGCCTCCTAAAGACATCCGTCGATTCTAG
Predicted protein sequences of Glyma09g04910
>Glyma09g04910.1   sequence type=predicted peptide   gene model=Glyma09g04910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVEPVEPQSLKKLSFKSLKRALDLFSPIHGHLATPDAESKKIRTSHKVSVEYGGIKSTANQPPPRQVSSATQDPGSSNTLALPGPGDSKDSQKGGPQNALVVGPTIPSTTPNDTGFQNKSTAVVSASGSSERNLSTSALMERMPSKWPRPVWHAPWKNYRVISGHLGWVRSVAVDPSNTWFCTGSADRTIKIWDLASGVLKLTLTGHIEQVRGLAVSNRHTYMFSAGDDKQVKCWDLEQNKVIRSYHGHLSGVYCLALHPTIDVLLTGGRDSVCRVWDIRSKMQIHALSGHDNTVCSVFTRPTDPQVVTGSHDTTIKMWDLRYGKTMSTLTNHKKSVRAMAQHPKEQAFASASADNIKKFTLPKGEFCHNMLSQQKTIINAMAVNEEGVMVTGGDNGSMWFWDWKSGHNFQQSQTIVQPGSLDSEAGIYACTYDLTGSRLITCEADKTIKMWKEDESATPETHPLNFRPPKDIRRF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo