Glyma09g04750 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g04750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g04750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g04750

Feature Type:	gene_model
Chromosome:	Gm09
Start:	3569894
stop:	3571414
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g04750

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G16720	AT	Annotation by Michelle Graham. TAIR10: TOXICOS EN LEVADURA 2 \| chr3:5692880-5693794 FORWARD LENGTH=304	SoyBase	E_val: 5.00E-67	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0002679	GO-bp	Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006952	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response	SoyBase	N/A	ISS
GO:0009595	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009612	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to mechanical stimulus	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009814	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0035556	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0043900	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PTHR22764	Panther	RING FINGER PROTEIN 11 (SID 1669) (NEDD4 WW DOMAIN-BINDING PROTEIN 2).	JGI		ISS
PTHR22764:SF15	Panther	ZINC FINGER (C3HC4-TYPE RING FINGER) FAMILY PROTEI	JGI		ISS
PF00097	PFAM	Zinc finger, C3HC4 type (RING finger)	JGI		ISS
UniRef100_B9RT88	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ring finger protein, putative n=1 Tax=Ricinus communis RepID=B9RT88_RICCO	SoyBase	E_val: 4.00E-78	ISS
UniRef100_C6TE62	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=C6TE62_SOYBN	SoyBase	E_val: 1.00E-150	ISS

Expression Patterns of Glyma09g04750

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g04750 not represented in the dataset	Glyma09g04750 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g04750 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g042400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g04750

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g04750

Limit To All Plant Sequences

>Glyma09g04750.1   sequence type=CDS   gene model=Glyma09g04750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAAGATGGGAACAACAACGATGTACCCTTACACAAATTCAAAGACAGCAATCCAAACCCTGAAGAGTTCGATGCAAAGGGTTACAGCCTCAGCGGAAAAATCATGCTTTCAGCAATAATCCTTCTTTTCTTCGTCGTCGTTTTGATGTTGTGCCTTCATATCTACGCGCGCTGGTACCTCCGGCGTGCTCGCCGCCGCCAGCTCCGGCGCCAACGCGAGCTCCGCCGCACCCAGCTTGTCTTTTACAACGACGACGCCACCCCCGCAGCCGTGTCACGTGGCCTCGACGCCGCCATCCTTGCCACGCTCCCCGTCTTCACCTTCGACCCGGAAAAAACCGGGCCGGAGTGCGCTGTTTGCTTGTCGGAGTTCGAACCCGGTGAAACGGGTCGGGTCTTGCCCAAATGTAATCACAGTTTCCACATAGAATGTATTGACATGTGGTTCCATTCTCATGACACGTGTCCTCTTTGTCGCGCCCCGGTTGAACGCGCGCCGGAACCGGAAGTTGTTGTTATAACAGTACCCGATCCGGTTTCCGAAACCGGTTCAGGCGAAAATGAGAACCGAACCGGTTCTTCTTCTTCTTCCTCTTCGGTTGGATTGAGTAAGCCTAAGCCTTCGTTGGTTGGTGTGACAATTGAGGTGCCTCCGAGGGACGAGAATTTTCAAAACGAGTTGCAACCGAGTTGCGACTCATCCTCCTCGTTTCGGTCGCCGATGAGTCGCATGCTGTCGTTTACGAGGATGCTCGGCAGGGAAAAGAAGGGGAACGTGTCGCCGTCGTCGTGCGGCGGCGGCGATTGTAGCTCCGCCGCGGAGCGAGGTGAGCGAGAGGAGACTCAGTGA

Predicted protein sequences of Glyma09g04750

Limit To All Plant Sequences

>Glyma09g04750.1   sequence type=predicted peptide   gene model=Glyma09g04750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEDGNNNDVPLHKFKDSNPNPEEFDAKGYSLSGKIMLSAIILLFFVVVLMLCLHIYARWYLRRARRRQLRRQRELRRTQLVFYNDDATPAAVSRGLDAAILATLPVFTFDPEKTGPECAVCLSEFEPGETGRVLPKCNHSFHIECIDMWFHSHDTCPLCRAPVERAPEPEVVVITVPDPVSETGSGENENRTGSSSSSSSVGLSKPKPSLVGVTIEVPPRDENFQNELQPSCDSSSSFRSPMSRMLSFTRMLGREKKGNVSPSSCGGGDCSSAAERGEREETQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain