SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g04750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g04750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g04750

Feature Type:gene_model
Chromosome:Gm09
Start:3569894
stop:3571414
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G16720AT Annotation by Michelle Graham. TAIR10: TOXICOS EN LEVADURA 2 | chr3:5692880-5693794 FORWARD LENGTH=304 SoyBaseE_val: 5.00E-67ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009612GO-bp Annotation by Michelle Graham. GO Biological Process: response to mechanical stimulus SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR22764Panther RING FINGER PROTEIN 11 (SID 1669) (NEDD4 WW DOMAIN-BINDING PROTEIN 2). JGI ISS
PTHR22764:SF15Panther ZINC FINGER (C3HC4-TYPE RING FINGER) FAMILY PROTEI JGI ISS
PF00097PFAM Zinc finger, C3HC4 type (RING finger) JGI ISS
UniRef100_B9RT88UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ring finger protein, putative n=1 Tax=Ricinus communis RepID=B9RT88_RICCO SoyBaseE_val: 4.00E-78ISS
UniRef100_C6TE62UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=C6TE62_SOYBN SoyBaseE_val: 1.00E-150ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g04750 not represented in the dataset

Glyma09g04750 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g042400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g04750.1   sequence type=CDS   gene model=Glyma09g04750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAAGATGGGAACAACAACGATGTACCCTTACACAAATTCAAAGACAGCAATCCAAACCCTGAAGAGTTCGATGCAAAGGGTTACAGCCTCAGCGGAAAAATCATGCTTTCAGCAATAATCCTTCTTTTCTTCGTCGTCGTTTTGATGTTGTGCCTTCATATCTACGCGCGCTGGTACCTCCGGCGTGCTCGCCGCCGCCAGCTCCGGCGCCAACGCGAGCTCCGCCGCACCCAGCTTGTCTTTTACAACGACGACGCCACCCCCGCAGCCGTGTCACGTGGCCTCGACGCCGCCATCCTTGCCACGCTCCCCGTCTTCACCTTCGACCCGGAAAAAACCGGGCCGGAGTGCGCTGTTTGCTTGTCGGAGTTCGAACCCGGTGAAACGGGTCGGGTCTTGCCCAAATGTAATCACAGTTTCCACATAGAATGTATTGACATGTGGTTCCATTCTCATGACACGTGTCCTCTTTGTCGCGCCCCGGTTGAACGCGCGCCGGAACCGGAAGTTGTTGTTATAACAGTACCCGATCCGGTTTCCGAAACCGGTTCAGGCGAAAATGAGAACCGAACCGGTTCTTCTTCTTCTTCCTCTTCGGTTGGATTGAGTAAGCCTAAGCCTTCGTTGGTTGGTGTGACAATTGAGGTGCCTCCGAGGGACGAGAATTTTCAAAACGAGTTGCAACCGAGTTGCGACTCATCCTCCTCGTTTCGGTCGCCGATGAGTCGCATGCTGTCGTTTACGAGGATGCTCGGCAGGGAAAAGAAGGGGAACGTGTCGCCGTCGTCGTGCGGCGGCGGCGATTGTAGCTCCGCCGCGGAGCGAGGTGAGCGAGAGGAGACTCAGTGA

>Glyma09g04750.1   sequence type=predicted peptide   gene model=Glyma09g04750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEDGNNNDVPLHKFKDSNPNPEEFDAKGYSLSGKIMLSAIILLFFVVVLMLCLHIYARWYLRRARRRQLRRQRELRRTQLVFYNDDATPAAVSRGLDAAILATLPVFTFDPEKTGPECAVCLSEFEPGETGRVLPKCNHSFHIECIDMWFHSHDTCPLCRAPVERAPEPEVVVITVPDPVSETGSGENENRTGSSSSSSSVGLSKPKPSLVGVTIEVPPRDENFQNELQPSCDSSSSFRSPMSRMLSFTRMLGREKKGNVSPSSCGGGDCSSAAERGEREETQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo