SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g04270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g04270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g04270

Feature Type:gene_model
Chromosome:Gm09
Start:3138037
stop:3142254
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G16155AT Annotation by Michelle Graham. TAIR10: dihydrolipoyl dehydrogenases | chr4:9153570-9157322 REVERSE LENGTH=630 SoyBaseE_val: 0ISS
GO:0042744GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process SoyBaseN/AISS
GO:0045454GO-bp Annotation by Michelle Graham. GO Biological Process: cell redox homeostasis SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0004148GO-mf Annotation by Michelle Graham. GO Molecular Function: dihydrolipoyl dehydrogenase activity SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016668GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on a sulfur group of donors, NAD(P) as acceptor SoyBaseN/AISS
GO:0050660GO-mf Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding SoyBaseN/AISS
PTHR22912Panther DISULFIDE OXIDOREDUCTASE JGI ISS
PTHR22912:SF49Panther SUBFAMILY NOT NAMED JGI ISS
PF00070PFAM Pyridine nucleotide-disulphide oxidoreductase JGI ISS
PF00890PFAM FAD binding domain JGI ISS
PF02852PFAM Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain JGI ISS
UniRef100_I1MGG7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Dihydrolipoyl dehydrogenase n=1 Tax=Glycine max RepID=I1MGG7_SOYBN SoyBaseE_val: 0ISS
UniRef100_UPI000233C78EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C78E related cluster n=1 Tax=unknown RepID=UPI000233C78E SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g04270 not represented in the dataset

Glyma09g04270 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma15g15310 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g038000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g04270.2   sequence type=CDS   gene model=Glyma09g04270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACAAAAAAGTTACTTTTATTGAAGCTTTAGACCAGCTCATGCCGGGATTTGATCCTGAAATTAGCAAGTTGGCTCAGAGGGTTCTCATAAATCCCCGGAATATTGACTATCATACTGGAGTTTTTGCATCCAAGATCACTCCTGCAAGAGATGGAAAACCTGTCACAATTGAGCTCATTGATGCAAAGACCAAGGAACAAAAGGACAGTTTAGAGGTGGATGCTGCACTAATAGCAACAGGAAGGGCTCCATTTACACAAGGTCTTGGATTGGAGAATATTGATGTTGTAACACAGCGTGGTTTTGTTCCTGTGGATGAGCGCATGAGAGTACTTGATGCAAATGGAAACCTGGTTCCTCATTTGTATTGCATTGGTGATACAAATGGCAAGATGATGCTTGCTCATGCTGCCAGTGCACAAGGAATTTCAGTGGTTGAACAAGTCACTGGAAGAGATCACGTGCTCAATCATTTAAGCATACCAGCTGCTTGTTTCACTCATCCTGAAATCAGCATGGTTGGATTGACTGAGCCTCAAGCAAGGGAGAAAGCTGAAAAGGAGGGTTTTGAAGTAAGTGTTGCCAAAACAAGTTTTAAAGCTAACACAAAGGCCTTAGCTGAAAACGAAGGGGAGGGTCTTGCCAAGTTGATATACAGACCTGACACTGGAGAGATATTGGGAGTCCATATATTTGGGTTGCATGCTGCTGATCTCATCCACGAGGCATCCAATGCAATAGCACTAGGATCACACATTCAGGATATAAAATTTGCAGTTCATGCTCATCCGACTTTGTCTGAGGTGCTTGATGAGCTATTTAAATCTGCAAAG

>Glyma09g04270.2   sequence type=predicted peptide   gene model=Glyma09g04270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDKKVTFIEALDQLMPGFDPEISKLAQRVLINPRNIDYHTGVFASKITPARDGKPVTIELIDAKTKEQKDSLEVDAALIATGRAPFTQGLGLENIDVVTQRGFVPVDERMRVLDANGNLVPHLYCIGDTNGKMMLAHAASAQGISVVEQVTGRDHVLNHLSIPAACFTHPEISMVGLTEPQAREKAEKEGFEVSVAKTSFKANTKALAENEGEGLAKLIYRPDTGEILGVHIFGLHAADLIHEASNAIALGSHIQDIKFAVHAHPTLSEVLDELFKSAK







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo