SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g02760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g02760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g02760

Feature Type:gene_model
Chromosome:Gm09
Start:1919744
stop:1920457
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G23410AT Annotation by Michelle Graham. TAIR10: Ribosomal protein S27a / Ubiquitin family protein | chr1:8314940-8315410 FORWARD LENGTH=156 SoyBaseE_val: 1.00E-88ISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009165GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0052541GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall cellulose metabolic process SoyBaseN/AISS
GO:0052546GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall pectin metabolic process SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0022627GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG0004 KOG Ubiquitin/40S ribosomal protein S27a fusion JGI ISS
PTHR10666Panther UBIQUITIN JGI ISS
PF00240PFAM Ubiquitin family JGI ISS
PF01599PFAM Ribosomal protein S27a JGI ISS
UniRef100_G7L814UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin n=2 Tax=Medicago truncatula RepID=G7L814_MEDTR SoyBaseE_val: 5.00E-95ISS
UniRef100_I1L0E5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L0E5_SOYBN SoyBaseE_val: 2.00E-109ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g02760 not represented in the dataset

Glyma09g02760 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma15g13650 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g023700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma09g02760.1   sequence type=CDS   gene model=Glyma09g02760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAGATATTCGTGAAAACCCTAACGGGGAAGACGATAACCCTAGAGGTAGAGTCTTCGGACACGATCGACAATGTGAAGGCGAAGATCCAGGACAAGGAGGGCATCCCGCCGGATCAGCAGCGCCTGATCTTCGCCGGAAAGCAGCTGGAGGACGGGCGCACCCTTGCCGACTACAACATCCAGAAGGAGTCCACCCTCCACCTCGTCCTCCGCCTCCGCGGCGGCGCCAAGAAGCGCAAGAAGAAGACCTACACCAAGCCCAAGAAGATCAAGCACAAGCACAAGAAGGTCAAGCTCGCCCTCCTCCAGTTCTACAAGGTCGACGACTCCGGCAAGCTCCAGAGGCTCCGCAAGGAGTGCCCCAATGCCGAATGTGGCGCCGGGACCTTCATGGCCAACCACTTCGACCGCCACTACTGTGGCAAGTGCGGATTGACCTATGTTTACCAGAAATCTGAAGCTTAG

>Glyma09g02760.1   sequence type=predicted peptide   gene model=Glyma09g02760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGAKKRKKKTYTKPKKIKHKHKKVKLALLQFYKVDDSGKLQRLRKECPNAECGAGTFMANHFDRHYCGKCGLTYVYQKSEA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo