SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g02160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g02160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g02160

Feature Type:gene_model
Chromosome:Gm09
Start:1438000
stop:1441584
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g02160
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G49720AT Annotation by Michelle Graham. TAIR10: glycosyl hydrolase 9A1 | chr5:20197765-20200168 REVERSE LENGTH=621 SoyBaseE_val: 0ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009734GO-bp Annotation by Michelle Graham. GO Biological Process: auxin mediated signaling pathway SoyBaseN/AISS
GO:0009735GO-bp Annotation by Michelle Graham. GO Biological Process: response to cytokinin stimulus SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010193GO-bp Annotation by Michelle Graham. GO Biological Process: response to ozone SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016051GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate biosynthetic process SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0030243GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose metabolic process SoyBaseN/AISS
GO:0030244GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose biosynthetic process SoyBaseN/AISS
GO:0032880GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein localization SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0042744GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0043622GO-bp Annotation by Michelle Graham. GO Biological Process: cortical microtubule organization SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0048367GO-bp Annotation by Michelle Graham. GO Biological Process: shoot development SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005769GO-cc Annotation by Michelle Graham. GO Cellular Compartment: early endosome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009504GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell plate SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
GO:0008810GO-mf Annotation by Michelle Graham. GO Molecular Function: cellulase activity SoyBaseN/AISS
PTHR22298Panther ENDO-1,4-BETA-GLUCANASE JGI ISS
PF00759PFAM Glycosyl hydrolase family 9 JGI ISS
UniRef100_I1L090UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1L090_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q27SZ6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Endo-1,4-beta-glucancase (Fragment) n=1 Tax=Glycine max RepID=Q27SZ6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma09g02160
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g02160 not represented in the dataset
Glyma09g02160 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g02160
ParalogEvidenceComments
Glyma15g13080 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g02160 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g018500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g02160
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g02160
>Glyma09g02160.1   sequence type=CDS   gene model=Glyma09g02160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTATTCTAGAGATTCATGGGGTGGACCGTTGGAGATAAACGCGACGGACTCGGCGACGGAGGACGAGCGGAGCCGGAACCTGCAGGACGTTGACAGGGCAGCGCTGTCGCGTCCCTTGGATGAGACGCAGCAGAGCTGGCTCCTTGGCCCCGGCGAGCAGAAGAAGAAGAAGTACGTCGATCTCGGCTGCATCATCGTCAGCCGCAAGATCTTCAAGTGGACCCTCGGCACAATCCTCTTCGCCGCCTTCCTCGCCGGCCTCATCGCCCTCATCGTCAACACCGTCCCCCGCCACCGCCACAAACACCCCCCTCCCGACAACTACACCCTCGCCCTCCACAAGGCCCTCATGTTCTTCAATGCCCAACGATCGGGGAAGTTGCCCAAGCATAACAATGTTTCATGGAGGGGAAACTCGGGAATGCAAGATGGGAAGTCTTCAGATCATTCTGCTGCGATTAAGGATCTGGTGGGTGGGTACTATGATGCCGGGGATGCTATCAAGTTTAACTTTCCTGCTTCGTTTTCCATTACTATGTTGAGTTGGAGTGTGATTGAGTATAGTGCAAAATATGAGGCTGCTGGGGAGCTTGAACATGTTAAGGAGATCATTAAGTGGGGTACTGATTATTTTCTCAAGAGTTTCAATAGTACTGCTGACACCATCACCACCCTTGCTGCTCAGGTTGGGCTTGGAGATACTTCCGGTGGTGACAGTCCGAATGACCACTATTGCTGGATGCGCCCAGAGGACATGGACTATGACCGCCCTGTGACTGAATGCCATAGTTGTTCTGATCTTGCAGCTGAGATGGCTGCTGCCTTGGCATCTGCTTCCATTGTTTTCAAGGACAACAAGGCCTATTCGAAGAAACTAGTTCATGGTGCTACCACGCTGTTCAAGTTTTCTAGGGAGCAGAGAGGCAGGTACAGTGCAGGGAGTTCGGAAGCTTCTATATTTTACAATTCTACCAGTTACTGGGATGAGTATGTTTGGGGAGGCGCATGGATGTACTTTGCAACTGGAAATTCATCGTACCTTAAGCTTGCTACTGCTCCTGGCCTGGCCAAGCATGCTGGTGCCTTCTGGGGAGGCCCTGATTATGGGGTACTCAGCTGGGATAACAAGCTTGCTGGTGCTCAGGTTCTTCTGAGTCGTTTGAGGTTGTTCTTGAGTCCTGGGTATCCATATGAAGAAATTTTGAGGACCTTTCACAATCAGACAAGCATAATCATGTGCTCCTATCTACCAGTTTTCACAAGCTTTAACAGAACCAAAGGTGGCTTGATTCAATTAAACCATGGTAGGCCTCAGCCTCTCCAATATGTGGTCAATGCGGCCTTTTTGGCTGCCCTATATAGTGATTATCTTGATGCTGCTGATACACCTGGATGGTATTGTGGACCTAATTTCTTTTCAACCGACGTGCTCCGTAGCTTTGCCAAGTCCCAGATTGATTACATCCTTGGAAATAACCCAAGGAAAATGAGTTATGTCGTAGGTTTTGGTAATCATTACCCAAAACACGTCCACCATAGAGGAGCATCTGTACCGAAGAACAAGATCAAGTATAGCTGTAAAGGTGGATGGAAATGGAGGGACACTTCTAAGCCAAACCCAAATACAATTGTTGGTGCCATGGTTGCCGGTCCTGACAAGCATGATGGCTTCCATGATGTTCGTACAAACTACAATTACACAGAGCCAACACTTGCTGGAAATGCCGGTTTAGTTGCTGCACTAGTGGCATTGTCAGGCGACAAAGGCACATCTATTGACAAAAATACCATTTTCTCTGCTGTTCCCCCAATGTTTCCTACACCGCCACCACCTCCAGCGCCATGGAAACCATAA
Predicted protein sequences of Glyma09g02160
>Glyma09g02160.1   sequence type=predicted peptide   gene model=Glyma09g02160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYSRDSWGGPLEINATDSATEDERSRNLQDVDRAALSRPLDETQQSWLLGPGEQKKKKYVDLGCIIVSRKIFKWTLGTILFAAFLAGLIALIVNTVPRHRHKHPPPDNYTLALHKALMFFNAQRSGKLPKHNNVSWRGNSGMQDGKSSDHSAAIKDLVGGYYDAGDAIKFNFPASFSITMLSWSVIEYSAKYEAAGELEHVKEIIKWGTDYFLKSFNSTADTITTLAAQVGLGDTSGGDSPNDHYCWMRPEDMDYDRPVTECHSCSDLAAEMAAALASASIVFKDNKAYSKKLVHGATTLFKFSREQRGRYSAGSSEASIFYNSTSYWDEYVWGGAWMYFATGNSSYLKLATAPGLAKHAGAFWGGPDYGVLSWDNKLAGAQVLLSRLRLFLSPGYPYEEILRTFHNQTSIIMCSYLPVFTSFNRTKGGLIQLNHGRPQPLQYVVNAAFLAALYSDYLDAADTPGWYCGPNFFSTDVLRSFAKSQIDYILGNNPRKMSYVVGFGNHYPKHVHHRGASVPKNKIKYSCKGGWKWRDTSKPNPNTIVGAMVAGPDKHDGFHDVRTNYNYTEPTLAGNAGLVAALVALSGDKGTSIDKNTIFSAVPPMFPTPPPPPAPWKP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo