Glyma08g48310 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g48310

Feature Type:	gene_model
Chromosome:	Gm08
Start:	46941690
stop:	46942562
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g48310

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
PTHR11962	Panther	QUEUINE TRNA-RIBOSYLTRANSFERASE	JGI		ISS
PF01702	PFAM	Queuine tRNA-ribosyltransferase	JGI		ISS
UniRef100_B9SK81	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Queuine tRNA-ribosyltransferase, putative n=1 Tax=Ricinus communis RepID=B9SK81_RICCO	SoyBase	E_val: 1.00E-35	ISS
UniRef100_I1KZN2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KZN2_SOYBN	SoyBase	E_val: 3.00E-66	ISS

Expression Patterns of Glyma08g48310

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g48310 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g367700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g48310

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g48310

Limit To All Plant Sequences

>Glyma08g48310.1   sequence type=CDS   gene model=Glyma08g48310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGCCCATTTTAGGAAACTGCACCTGCTATAAATGCCAGAGTCATACTAAAGCATACATCAATCACCTATTTAATGTTCATGAAATGCTGGCACGGATTCTGCTAGAGATCCATAATACACACCACTATTTGGCGTTCTTTCTTGTAATAAGAGAAGCAATAAAGGATGGAAGGTTTGAGAAATTTCGACAGACGTTCATCCAGAGCAGGCGTGCCCATCACGAAGGGGAAGCTGTTTGTGCTTGTGGTCATATAAGTTTAGGTGTATACATTGGGTTTTACCTAAGATTTCTATGA

Predicted protein sequences of Glyma08g48310

Limit To All Plant Sequences

>Glyma08g48310.1   sequence type=predicted peptide   gene model=Glyma08g48310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSPILGNCTCYKCQSHTKAYINHLFNVHEMLARILLEIHNTHHYLAFFLVIREAIKDGRFEKFRQTFIQSRRAHHEGEAVCACGHISLGVYIGFYLRFL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain