Glyma08g48050 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g48050): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g48050): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g48050

Feature Type:	gene_model
Chromosome:	Gm08
Start:	46778586
stop:	46779788
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g48050

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
ATMG00560	AT	Annotation by Michelle Graham. TAIR10: Nucleic acid-binding, OB-fold-like protein \| chrM:154744-157345 FORWARD LENGTH=349	SoyBase	E_val: 8.00E-45	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005762	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial large ribosomal subunit	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
PTHR13691	Panther	RIBOSOMAL PROTEIN L2	JGI		ISS
PTHR13691:SF2	Panther	50S RIBOSOMAL PROTEIN L2P	JGI		ISS
PF00181	PFAM	Ribosomal Proteins L2, RNA binding domain	JGI		ISS
UniRef100_D5I3E9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein L2 n=1 Tax=Cucurbita pepo RepID=D5I3E9_CUCPE	SoyBase	E_val: 1.00E-54	ISS
UniRef100_UPI0001BA5DF7	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0001BA5DF7 related cluster n=1 Tax=unknown RepID=UPI0001BA5DF7	SoyBase	E_val: 1.00E-142	ISS

Expression Patterns of Glyma08g48050

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g48050 not represented in the dataset	Glyma08g48050 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g48050 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g365200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g48050

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g48050

Limit To All Plant Sequences

>Glyma08g48050.2   sequence type=CDS   gene model=Glyma08g48050   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGGCGTGAAGAGAGCACTGAGGCAGTTCACCTTCGGAACCGGCAAGACCGCCGGTCGCAACTCGGCGGGGCGCATAACGTCCTTCCACCGCGGCGGCGGAGCCAAGCGCTTGCAACGAACCGTCGATCACAAACGGAATACCGCTTCTTCTCTCGGCGTCGTCGAAAGGATCGAGTACGACCCTAACCGCTCCTCCAAAATCGCCCTCGTTCGCTGGATCGAAGGCGTCCATCACCGTCGCCGCCGCGCTGCCTCCGCCAACGCCGCTTCGCCCAAGCTCCTCCATCTCGATCCCGCCACTAACGACGCTAACAGCATTCGCGGCGTTTTCGCTCTCAATTCGATGCTGCCGCACACTCACGCTGGAACATCCTCCAGAGAGCTTTTTCTGTCTGCGTTGGCGTCCAAGGCCAAGGGATCAGAATCGGAATCGGTTTCTTCGCTCGGAATTCCGAGGTTCGCGGTTGCGGCGGCGAGGGCTCCGTTCTTCGCGCAGCGTGCGAGAGGGGAGGAGACGTTGGAGGTTCGGCATTGGAGAAGGAATAGCGACGCGTGGGCGCATAGGAACAAACGTAAAGCAGCGATTTCGTGGCAAAGCATTGCTCGTTGA

Predicted protein sequences of Glyma08g48050

Limit To All Plant Sequences

>Glyma08g48050.2   sequence type=predicted peptide   gene model=Glyma08g48050   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGVKRALRQFTFGTGKTAGRNSAGRITSFHRGGGAKRLQRTVDHKRNTASSLGVVERIEYDPNRSSKIALVRWIEGVHHRRRRAASANAASPKLLHLDPATNDANSIRGVFALNSMLPHTHAGTSSRELFLSALASKAKGSESESVSSLGIPRFAVAAARAPFFAQRARGEETLEVRHWRRNSDAWAHRNKRKAAISWQSIAR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain