Glyma08g48040 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g48040

Feature Type:	gene_model
Chromosome:	Gm08
Start:	46769826
stop:	46771587
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g48040

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G02550	AT	Annotation by Michelle Graham. TAIR10: LOB domain-containing protein 41 \| chr3:536747-537650 REVERSE LENGTH=263	SoyBase	E_val: 3.00E-102	ISS
GO:0001666	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hypoxia	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
PF03195	PFAM	Protein of unknown function DUF260	JGI		ISS
UniRef100_G7KMR0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: LOB domain-containing protein n=1 Tax=Medicago truncatula RepID=G7KMR0_MEDTR	SoyBase	E_val: 1.00E-106	ISS
UniRef100_I1KZL3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KZL3_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma08g48040

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g48040

Paralog	Evidence	Comments
Glyma18g53440	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g48040 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g365100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g48040

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g48040

Limit To All Plant Sequences

>Glyma08g48040.2   sequence type=CDS   gene model=Glyma08g48040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCGGATGAGTTGCAATGGATGTCGAGTTCTGAGAAAAGGTTGCAGTGAAAATTGCAGCATCAGACCCTGTTTACAATGGATCAAAAGCCCAGAATCCCAAGCCAATGCTACTGTGTTTCTCGCTAAGTTTTATGGTCGTGCTGGTCTCATGAACCTCGTTAACGCAGGCCCCGAACATCTTCGTCCAGCGATCTTTCGCTCGTTGTTGTACGAGGCATGCGGTCGGATAGTGAACCCGATTTACGGGTCTGTCGGGCTATTATGGTCCGGGAGCTGGCAGCTGTGTCAAGCCGCCGTGGAAAACGTCTTGAAAGGCGCGCCGATTACGCCGATCACGTCTGAAGCCGCGGCTAGCGGGCGGTGCCCACCGCTCAAGGCTTACGACATACGCCACGTGTTCAAAGACGAGAACTCCGCCGCCGCGTCCAACGAAACTCAGCACCAACGAGTCAAGACCCGCTCTCGAGTGAAGCGACCCCTCGCCAAGCCCAAATCCACCGCCAACCAAAACAACAACATTAACACTAAGAATACGGGAACCGAATTCGGATCGGATGAACCGGGTTTGGTGGCATGCGATTGGACCGAGGAGGCGTTGAACCGGTCTGGAAGTCACGATTCGACGCTGAGCCACCAGTCGGAGGCGGCGAATGCGGTGGAAAGTGAGAGCATTTTGTCTGCTGAGACTTCGATCCTCTTCCGAGATGAACCGGAATCCAACCCGAAGCGCTTGGACCGGACCGATGATGTTGGTTTAGAGCTTACGCTAGGGTTCGAGCCGGTATCAGGTGCGCAGCACGTGGTTCCGGTGAAGAAGAGAAGGATTGATTTGAAGGATTTTAGTGGCTCGTCGTGCAAGATGGAGCTGGGGCTTGAATGCTCGGCTTGA

Predicted protein sequences of Glyma08g48040

Limit To All Plant Sequences

>Glyma08g48040.2   sequence type=predicted peptide   gene model=Glyma08g48040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRMSCNGCRVLRKGCSENCSIRPCLQWIKSPESQANATVFLAKFYGRAGLMNLVNAGPEHLRPAIFRSLLYEACGRIVNPIYGSVGLLWSGSWQLCQAAVENVLKGAPITPITSEAAASGRCPPLKAYDIRHVFKDENSAAASNETQHQRVKTRSRVKRPLAKPKSTANQNNNINTKNTGTEFGSDEPGLVACDWTEEALNRSGSHDSTLSHQSEAANAVESESILSAETSILFRDEPESNPKRLDRTDDVGLELTLGFEPVSGAQHVVPVKKRRIDLKDFSGSSCKMELGLECSA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain