SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g47951

Feature Type:gene_model
Chromosome:Gm08
Start:46704994
stop:46707798
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g47951
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G02280AT Annotation by Michelle Graham. TAIR10: Flavodoxin family protein | chr3:453646-457659 FORWARD LENGTH=623 SoyBaseE_val: 4.00E-107ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0010212GO-bp Annotation by Michelle Graham. GO Biological Process: response to ionizing radiation SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0010181GO-mf Annotation by Michelle Graham. GO Molecular Function: FMN binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016651GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on NAD(P)H SoyBaseN/AISS
PTHR19384Panther NADPH FLAVIN OXIDOREDUCTASE JGI ISS
PTHR19384:SF10Panther OXIDOREDUCTASE JGI ISS
PF00175PFAM Oxidoreductase NAD-binding domain JGI ISS
PF00667PFAM FAD binding domain JGI ISS
UniRef100_A2Q1Q9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Flavoprotein pyridine nucleotide cytochrome reductase n=1 Tax=Medicago truncatula RepID=A2Q1Q9_MEDTR SoyBaseE_val: 9.00E-127ISS
UniRef100_I1KZK4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KZK4_SOYBN SoyBaseE_val: 2.00E-170ISS

Expression Patterns of Glyma08g47951
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g47951 not represented in the dataset
Glyma08g47951 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g47951
ParalogEvidenceComments
Glyma18g53510 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g47951 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g364300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g47951
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g47951
>Glyma08g47951.1   sequence type=CDS   gene model=Glyma08g47951   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAAGGCATACTTTACGCCTCTCAGAACGGCAATGCATTGGACGCCTACGAAGCTTCTCTGGATCCTTGGCTGTCTTCTTTGTGGAGAATGTTAAGCATGATTAAACCAGAATTCTTACCAAATGGTCCTGATGTTGTGATTCAAGATACAGTACTGATTCATCAACCCAAAGTCCAGATCACGTATCACAACATTGCAAATGACAAGTCTCATTTTTCTAGTGCCTCGGATTTAACATGTCTTAATGTGCAAATTGGGAGTGCTCGATCAGTGCACCCTGGAAAATCATCTTCTGACAGAAGTAGGCCTGGCTGCTTTCTTAAGATGGCGATAGAGGATATTCCTTCTGTACAAATGCGGTTTGAGTGGCTAGTCCAATTAGTTCCCCCCCTGCAACCAAGAGCCTTCTCCATATCTTCTTCTCAATCAGCTCACCCCAATCAAGTACACTTGACTGTGAATGTGGTGTCTTGGACAACACCTTACAAGAGGGAAAAAAAAAGGACTATGCTCCTCTTTATCTCTATATGTATCCATGTTCCAGCCTGGTTCCATAAAGGTTTACTTCCTACACCATCACCGTCACTCCCCCTCATACTTGTTGGACCTGGAACAGGATGTGCACCTTTTTGTGGATTTGTAGAGGAAAGAGCATTGCAAAGTAGAACTAATTCCACTGATCCAATTATTTTTTTCTTTGGCTGTTGGAATGAAAATGGTGACTTTCTGTACCGTGACTTTTGGTTGAGTCATTCACAGAACAAAGGGGTGCTTTCAGAAGCAAAAGGTGGAGGTTTCTATGTTGCATTCTCTAGAGACCAGCCCCAGAAGGTTTATGTTCAACATAAGATGAGGGAGCAGAGCCAAAGGATCTGGAACCTATTAGCTGAGGGGGCTGCTGTTTATATAGCAGGTTTTTCAAGGAAAATGCCTGCAGATGTAACATCAGCTTTTGAGGAAATTGTATCCAAGGAAAATGAGGTTTCAAGAGAAGATGCAGTTAGGTGGATTAGAGCATTAGAAAAGTGTGGTAAGTTTCATATTGAGGCATAG
Predicted protein sequences of Glyma08g47951
>Glyma08g47951.1   sequence type=predicted peptide   gene model=Glyma08g47951   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKGILYASQNGNALDAYEASLDPWLSSLWRMLSMIKPEFLPNGPDVVIQDTVLIHQPKVQITYHNIANDKSHFSSASDLTCLNVQIGSARSVHPGKSSSDRSRPGCFLKMAIEDIPSVQMRFEWLVQLVPPLQPRAFSISSSQSAHPNQVHLTVNVVSWTTPYKREKKRTMLLFISICIHVPAWFHKGLLPTPSPSLPLILVGPGTGCAPFCGFVEERALQSRTNSTDPIIFFFGCWNENGDFLYRDFWLSHSQNKGVLSEAKGGGFYVAFSRDQPQKVYVQHKMREQSQRIWNLLAEGAAVYIAGFSRKMPADVTSAFEEIVSKENEVSREDAVRWIRALEKCGKFHIEA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo